Organism : Rhodobacter sphaeroides 2.4.1 | Module List :
RSP_3381

NAD(P)H -dependent quinone oxidoreductase (NCBI)

CircVis
Functional Annotations (7)
Function System
NADPH:quinone reductase and related Zn-dependent oxidoreductases cog/ cog
NADPH:quinone reductase activity go/ molecular_function
transporter activity go/ molecular_function
ATP binding go/ molecular_function
transport go/ biological_process
zinc ion binding go/ molecular_function
ATPase activity go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for RSP_3381
(Mouseover regulator name to see its description)

RSP_3381 is regulated by 33 influences and regulates 0 modules.
Regulators for RSP_3381 (33)
Regulator Module Operator
RSP_0032 57 tf
RSP_0601 57 tf
RSP_0768 57 tf
RSP_0927 57 tf
RSP_1669 57 tf
RSP_1866 57 tf
RSP_1952 57 tf
RSP_2130 57 tf
RSP_2171 57 tf
RSP_2591 57 tf
RSP_2681 57 tf
RSP_2730 57 tf
RSP_2939 57 tf
RSP_3324 57 tf
RSP_3620 57 tf
RSP_0722 175 tf
RSP_1032 175 tf
RSP_1092 175 tf
RSP_1577 175 tf
RSP_1590 175 tf
RSP_1866 175 tf
RSP_1952 175 tf
RSP_2171 175 tf
RSP_2533 175 tf
RSP_2610 175 tf
RSP_2730 175 tf
RSP_2838 175 tf
RSP_2867 175 tf
RSP_2889 175 tf
RSP_2939 175 tf
RSP_3324 175 tf
RSP_3606 175 tf
RSP_3665 175 tf

Warning: RSP_3381 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7834 6.30e-08 aaaAAAtCgG
Loader icon
7835 5.90e+00 ATCTATGCCCTTTGTGATATATA
Loader icon
8070 4.90e-06 AAAAaATccCccGaaTTcTCCCCG
Loader icon
8071 3.10e-01 at.cAgcC.CGtCcCgGGTGcGta
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for RSP_3381

RSP_3381 is enriched for 7 functions in 3 categories.
Enrichment Table (7)
Function System
NADPH:quinone reductase and related Zn-dependent oxidoreductases cog/ cog
NADPH:quinone reductase activity go/ molecular_function
transporter activity go/ molecular_function
ATP binding go/ molecular_function
transport go/ biological_process
zinc ion binding go/ molecular_function
ATPase activity go/ molecular_function
Module neighborhood information for RSP_3381

RSP_3381 has total of 57 gene neighbors in modules 57, 175
Gene neighbors (57)
Gene Common Name Description Module membership
RSP_0182 RSP_0182 None 95, 175
RSP_0302 ureG Urease accessory protein G (NCBI) 175, 307
RSP_0303 ureF Urease accessory protein UreF (NCBI) 175, 307
RSP_0304 ureE urease accessory protein UreE (NCBI) 175, 307
RSP_0305 RSP_0305 hypothetical protein (NCBI) 175, 307
RSP_0306 RSP_0306 Class I diheme cytochrome c (NCBI) 175, 307
RSP_0329 RSP_0329 GAF sensor diguanylate cyclase (GGDEF) (NCBI) 174, 175
RSP_0341 RSP_0341 Cytosine deaminase (NCBI) 57, 114
RSP_0342 RSP_0342 putative ABC sugar transporter, inner membrane subunit (NCBI) 57, 114
RSP_0343 RSP_0343 putative ABC sugar transporter, inner membrane subunit (NCBI) 57, 204
RSP_0344 RSP_0344 putative ABC sugar transporter, fused ATPase subunits (NCBI) 57, 204
RSP_0347 RSP_0347 ABC transporter, inner membrane subunit (NCBI) 57, 204
RSP_0348 RSP_0348 ABC transporter, inner membrane subunit (NCBI) 57, 204
RSP_0406 RSP_0406 periplasmic sensor diguanylate cyclase (GGDEF) (NCBI) 126, 175
RSP_0407 RSP_0407 putative lactate dehydrogenase (NCBI) 175, 384
RSP_0803 DppF ABC dipeptide transporter, ATPase subunit DppF (NCBI) 174, 175
RSP_0805 DppC ABC dipeptide transporter, inner membrane subunit DppC (NCBI) 57, 67
RSP_0889 glnK Nitrogen regulatory protein P-II (NCBI) 57, 358
RSP_0894 RSP_0894 hypothetical protein (NCBI) 175, 384
RSP_0895 RSP_0895 phosphodiesterase-like (NCBI) 7, 175
RSP_0943 yhxA probable adenosylmethionine-8-amino-7-oxononanoate aminotransferase (NCBI) 25, 175
RSP_1086 sdh saccharopine dehydrogenase (NAD+, L-lysine forming) (NCBI) 72, 175
RSP_1377 RSP_1377 Carbonic anhydrase (NCBI) 112, 175
RSP_1378 RSP_1378 hypothetical protein (NCBI) 175, 189
RSP_1379 RSP_1379 Cytosol aminopeptidase (NCBI) 175, 384
RSP_1380 RSP_1380 hypothetical protein (NCBI) 7, 175
RSP_1590 RSP_1590 two component, sigma54 specific, transcriptional regulator, fis family (NCBI) 175, 358
RSP_1946 RSP_1946 Cytochrome P450 hydroxylase (NCBI) 175, 381
RSP_2012 RSP_2012 NUDIX hydrolase, MutT (NCBI) 175, 242
RSP_2090 pycA Pyruvate carboxylase (NCBI) 16, 57
RSP_2158 RSP_2158 ABC transporter, periplasmic solute-binding protein (NCBI) 57, 59
RSP_2168 RSP_2168 hypothetical protein (NCBI) 126, 175
RSP_2188 RSP_2188 hypothetical protein (NCBI) 175, 214
RSP_2252 RSP_2252 Threonine dehydratase (NCBI) 145, 175
RSP_2253 RSP_2253 predicted hydrolases or acyltransferases (NCBI) 16, 175
RSP_2883 pgm Probable phosphoglucomutase/phosphomannomutase (NCBI) 175, 384
RSP_2898 RSP_2898 putative DNA polymerase III chi subunit (NCBI) 4, 175
RSP_2899 RSP_2899 Probable cytosol aminopeptidase (NCBI) 4, 175
RSP_3037 RSP_3037 Putative short-chain dehydrogenase/reductase (NCBI) 57, 168
RSP_3038 RSP_3038 ABC permidine/putrescine transporter, inner membrane subunit (NCBI) 57, 106
RSP_3039 RSP_3039 ABC permidine/putrescine transporter, inner membrane subunit (NCBI) 57, 106
RSP_3040 RSP_3040 ABC permidine/putrescine transporter, periplasmic substrate-binding protein (NCBI) 57, 106
RSP_3041 RSP_3041 ABC permidine/putrescine transporter, ATPase subunit (NCBI) 57, 106
RSP_3042 dorX DMSO reductase regulatory protein DorX (NCBI) 57, 106
RSP_3246 RSP_3246 putative D-alanyl-D-alanine carboxypeptidase (NCBI) 175, 384
RSP_3248 RSP_3248 ABC peptide transporter, periplasmic binding protein (NCBI) 57, 114
RSP_3381 RSP_3381 NAD(P)H -dependent quinone oxidoreductase (NCBI) 57, 175
RSP_3382 RSP_3382 hypothetical protein (NCBI) 57, 102
RSP_3383 RSP_3383 hypothetical protein (NCBI) 57, 102
RSP_3419 RSP_3419 hypothetical protein (NCBI) 175, 381
RSP_3513 RSP_3513 GAF sensor diguanylate cyclase (NCBI) 57, 293
RSP_3687 RSP_3687 ABC sugar transporter, periplasmic binding protein (NCBI) 57, 171
RSP_3688 RSP_3688 ABC sugar transporter, ATPase subunit (NCBI) 57, 171
RSP_3689 yphD ABC sugar transporter, inner membrane subunit (NCBI) 57, 88
RSP_3691 RSP_3691 putative cytoplasmic protein (NCBI) 31, 57
RSP_3758 RSP_3758 Cytosine-specific DNA methylase (NCBI) 57, 130
RSP_3759 RSP_3759 Putative endonuclease (NCBI) 130, 175
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for RSP_3381
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend