Organism : Synechococcus elongatus PCC 7942 | Module List :
Synpcc7942_0252

hypothetical protein

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Synpcc7942_0252
(Mouseover regulator name to see its description)

Warning: No Regulators were found for Synpcc7942_0252!

Warning: Synpcc7942_0252 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 6 motifs predicted.

Motif Table (6)
Motif Id e-value Consensus Motif Logo
1814 1.80e+00 CTTcTtcGCAaTcTcATTcaatC
Loader icon
1815 1.50e+04 ATGCGACCCCTCTTTTCTAAG
Loader icon
1816 3.10e+03 agGG.GtTacCGCTc
Loader icon
1862 0.00e+00 agggcGGaaA.CCG.cct
Loader icon
1863 6.50e+02 AAcgCTTggGAaaATtctc
Loader icon
1864 3.00e+03 CAAgAGgCtGATTgCttaCcAGCA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Synpcc7942_0252

Warning: No Functional annotations were found!

Module neighborhood information for Synpcc7942_0252

Synpcc7942_0252 has total of 47 gene neighbors in modules 98, 114
Gene neighbors (47)
Gene Common Name Description Module membership
Synpcc7942_0125 hisB imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19) (IMGterm) 74, 98
Synpcc7942_0252 hypothetical protein 98, 114
Synpcc7942_0253 hypothetical protein 114, 173
Synpcc7942_0254 DNA gyrase subunit A (EC 5.99.1.3) (IMGterm) 98, 110
Synpcc7942_0448 YUP8H12.25 {{Arabidopsis thaliana}}-type protein. Metallo peptidase. MEROPS family M50B (IMGterm) 49, 98
Synpcc7942_0589 Fe-S-cluster oxidoreductase-like 53, 98
Synpcc7942_0653 Peptidyl-prolyl cis-trans isomerase (rotamase) - cyclophilin family-like (EC:5.2.1.8) 74, 98
Synpcc7942_0654 photosystem I assembly related protein 74, 98
Synpcc7942_0794 membrane-associated 30 kD protein-like 84, 114
Synpcc7942_0817 "putative ferric uptake regulator, FUR family" 45, 114
Synpcc7942_0903 aconitase (EC 4.2.1.3) (IMGterm) 36, 98
Synpcc7942_0978 ferredoxin-NADP oxidoreductase (EC:1.18.1.2) 98, 110
Synpcc7942_1078 hypothetical protein 98, 144
Synpcc7942_1089 ATPase 114, 173
Synpcc7942_1101 PDZ/DHR/GLGF 114, 173
Synpcc7942_1153 hypothetical protein 114, 173
Synpcc7942_1154 hypothetical protein 114, 173
Synpcc7942_1195 hypothetical protein 84, 114
Synpcc7942_1331 CAB/ELIP/HLIP superfamily protein 98, 140
Synpcc7942_1434 hypothetical protein 98, 110
Synpcc7942_1448 quinolinate synthetase (EC 2.5.1.72) (IMGterm) 98, 144
Synpcc7942_1701 hypothetical protein 114, 128
Synpcc7942_1746 group2 RNA polymerase sigma factor SigB 107, 114
Synpcc7942_1758 23S rRNA m(2)A-2503 methyltransferase (EC 2.1.1.-) (IMGterm) 49, 98
Synpcc7942_1798 hypothetical protein 50, 114
Synpcc7942_1800 hypothetical protein 2, 114
Synpcc7942_1820 hypothetical protein 82, 114
Synpcc7942_1821 hypothetical protein 21, 114
Synpcc7942_1822 hypothetical protein 21, 114
Synpcc7942_1923 "RNA polymerase, sigma subunit, ECF family (IMGterm)" 2, 114
Synpcc7942_1937 peptide methionine sulfoxide reductase (EC:1.8.4.11) 45, 98
Synpcc7942_1996 hypothetical protein 98, 110
Synpcc7942_2015 conserved hypothetical protein YCF66 98, 110
Synpcc7942_2055 "2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase (EC 1.14.13.-) (IMGterm)" 45, 98
Synpcc7942_2126 hypothetical protein 114, 173
Synpcc7942_2143 "tryptophan synthase, beta chain (EC 4.2.1.20) (IMGterm)" 98, 136
Synpcc7942_2313 groEL Chaperonin Cpn60/TCP-1 2, 114
Synpcc7942_2314 groES "GroES protein, 10 kD chaperonin" 5, 114
Synpcc7942_2355 hypothetical protein 21, 114
Synpcc7942_2399 hypothetical protein 45, 98
Synpcc7942_2401 heat shock protein Hsp20 (IMGterm) 114, 173
Synpcc7942_2448 GTP-binding protein HflX (EC 3.1.5.-) (IMGterm) 114, 173
Synpcc7942_2468 Heat shock protein Hsp70 82, 114
Synpcc7942_2477 hypothetical protein 114, 173
Synpcc7942_2478 photosystem II reaction center W protein 114, 173
Synpcc7942_2506 phosphoadenylylsulfate reductase (thioredoxin) (EC 1.8.4.8) (IMGterm) 82, 114
Synpcc7942_2572 hypothetical protein 1, 114
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Synpcc7942_0252
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend