Organism : Halobacterium salinarum NRC-1 | Module List:
Module 61 Profile

GeneModule member RegulatorRegulator MotifMotif
Cytoscape Web
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 61

There are 3 regulatory influences for Module 61

Regulator Table (3)
Regulator Name Type
VNG1899G
VNG2243G
combiner
VNG0101G
VNG2441G
combiner
VNG1899G
VNG1029C
combiner

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
1097 1.30e-01 gGcaCCCaAcACgct.a.ca
Loader icon
1098 3.60e+00 TACATGGTACAACTAGATAATTAA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 61 is enriched for following functions.

KEGG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini Hochberg pvalue Genes with function Method
Glycolysis / Gluconeogenesis kegg pathway 4.00e-06 5.90e-05 4/28
Citrate cycle (TCA cycle) kegg pathway 6.00e-06 7.60e-05 4/28
Pyruvate metabolism kegg pathway 1.00e-06 1.90e-05 4/28
Glycine serine and threonine metabolism kegg pathway 1.19e-04 8.82e-04 3/28
Porphyrin and chlorophyll metabolism kegg pathway 0.00e+00 7.00e-06 5/28
Two-component system kegg pathway 4.40e-05 4.27e-04 3/28
Bacterial chemotaxis kegg pathway 0.00e+00 0.00e+00 5/28
Metabolic pathways kegg pathway 9.00e-06 1.13e-04 13/28
Biosynthesis of secondary metabolites kegg pathway 6.21e-03 1.26e-02 5/28
Microbial metabolism in diverse environments kegg pathway 6.00e-06 7.60e-05 7/28
Carbohydrate Metabolism kegg subcategory 0.00e+00 0.00e+00 14/28
Amino Acid Metabolism kegg subcategory 8.60e-05 6.42e-04 8/28
Metabolism of Cofactors and Vitamins kegg subcategory 0.00e+00 2.00e-06 8/28
Signal Transduction kegg subcategory 4.40e-05 3.69e-04 3/28
Cell Motility kegg subcategory 0.00e+00 0.00e+00 5/28
Metabolism kegg subcategory 0.00e+00 0.00e+00 25/28
Metabolism kegg category 0.00e+00 0.00e+00 34/28
Environmental Information Processing kegg category 3.79e-03 1.65e-02 4/28
Cellular Processes kegg category 0.00e+00 0.00e+00 5/28
Global kegg category 0.00e+00 0.00e+00 25/28
Metabolism kegg category 2.40e-05 2.75e-04 13/28
Carbohydrate Metabolism kegg subcategory 2.30e-03 8.36e-03 4/28
Glycolysis / Gluconeogenesis kegg pathway 4.00e-06 5.90e-05 4/28
Citrate cycle (TCA cycle) kegg pathway 6.00e-06 7.60e-05 4/28
Pyruvate metabolism kegg pathway 1.00e-06 1.90e-05 4/28
Amino Acid Metabolism kegg subcategory 3.25e-04 2.09e-03 6/28
Glycine serine and threonine metabolism kegg pathway 1.19e-04 1.01e-03 3/28
Metabolism of Cofactors and Vitamins kegg subcategory 0.00e+00 2.00e-06 8/28
Porphyrin and chlorophyll metabolism kegg pathway 0.00e+00 6.00e-06 5/28
Environmental Information Processing kegg category 3.36e-03 1.11e-02 4/28
Signal Transduction kegg subcategory 4.40e-05 4.57e-04 3/28
Two-component system kegg pathway 4.40e-05 4.57e-04 3/28
Cellular Processes kegg category 0.00e+00 0.00e+00 5/28
Cell Motility kegg subcategory 0.00e+00 0.00e+00 5/28
Bacterial chemotaxis kegg pathway 0.00e+00 0.00e+00 5/28
Global kegg category 1.30e-05 1.60e-04 13/28
Metabolism kegg subcategory 1.30e-05 1.60e-04 13/28
Metabolic pathways kegg pathway 9.00e-06 1.14e-04 13/28
Biosynthesis of secondary metabolites kegg pathway 6.21e-03 1.71e-02 5/28
Microbial metabolism in diverse environments kegg pathway 6.00e-06 7.70e-05 7/28

GO Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
two-component signal transduction system (phosphorelay) biological_process 2.00e-06 1.50e-05 3/28
electron transport biological_process 2.62e-03 4.52e-03 4/28
cobalamin biosynthetic process biological_process 2.90e-05 1.36e-04 4/28
flavin adenine dinucleotide binding molecular_function 1.10e-05 4.60e-05 3/28

TIGRFam Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Biosynthesis of cofactors, prosthetic groups, and carriers tigr mainrole 2.32e-04 1.98e-03 4/28
Biosynthesis of cofactors, prosthetic groups, and carriers tigr mainrole 2.32e-04 4.24e-04 4/28

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Signal transduction mechanisms cog subcategory 6.80e-05 1.72e-03 5/28
Cell motility cog subcategory 8.00e-05 1.95e-03 4/28
Energy production and conversion cog subcategory 2.48e-03 2.21e-02 5/28
Coenzyme transport and metabolism cog subcategory 1.20e-05 4.01e-04 7/28
Cellular processes and signaling cog category 2.43e-04 4.44e-03 10/28
Metabolism cog category 1.94e-04 3.82e-03 16/28
Cellular processes and signaling cog category 2.57e-02 3.90e-02 6/28
Metabolism cog category 7.20e-05 1.79e-04 16/28
Signal transduction mechanisms cog subcategory 6.80e-05 1.71e-04 5/28
Cell motility cog subcategory 8.00e-05 1.97e-04 4/28
Energy production and conversion cog subcategory 2.48e-03 4.38e-03 5/28
Coenzyme transport and metabolism cog subcategory 1.20e-05 3.20e-05 7/28
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 61

There are 28 genes in Module 61

Gene Member Table (28)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
VNG0932C CDS 1447666 chromosome 710638 711030 + hypothetical protein VNG0932C False
VNG0967Gm cheD CDS 1449033 chromosome 737643 738110 - chemotaxis protein False
VNG0970G cheC1 CDS 1447693 chromosome 739248 739835 - chemotaxis protein False
VNG0971G cheA CDS 1447694 chromosome 739838 741844 - hypothetical protein VNG0971G False
VNG0973G cheB CDS 1447695 chromosome 741846 742889 - hypothetical protein VNG0973G False
VNG0974G cheY CDS 1447696 chromosome 742886 743248 - hypothetical protein VNG0974G False
VNG1408G ush CDS 1448026 chromosome 1046073 1048121 - UDP-sugar hydrolase False
VNG1413H CDS 1448030 chromosome 1052148 1053737 - hypothetical protein VNG1413H False
VNG1414G glyA CDS 1448031 chromosome 1053950 1055224 + serine hydroxymethyltransferase False
VNG1554G cbiG CDS 1448137 chromosome 1159023 1160000 + cobalamin biosynthesis protein CbiG False
VNG1557G cbiH CDS 1448139 chromosome 1160827 1161834 + cobalamin biosynthesis protein False
VNG1558H CDS 1448140 chromosome 1161834 1162082 + hypothetical protein VNG1558H False
VNG1566G cobN CDS 1448145 chromosome 1167897 1171601 + hypothetical protein VNG1566G False
VNG1567G cbiC CDS 1448146 chromosome 1171591 1172304 + precorrin isomerase False
VNG1568G cbiJ CDS 1448147 chromosome 1172301 1173053 + cobalt-precorrin-6Y C(5)-methyltransferase False
VNG1933G ftsZ3 CDS 1448420 chromosome 1424535 1425587 + cell division protein False
VNG2151G etfA CDS 1448591 chromosome 1584874 1585842 + electron transfer flavoprotein subunit alpha False
VNG2217G pdhA2 CDS 1448646 chromosome 1646140 1647399 + pyruvate dehydrogenase alpha subunit False
VNG2218G pdhB CDS 1448647 chromosome 1647485 1648378 + hypothetical protein VNG2218G False
VNG2219G dsa CDS 1448648 chromosome 1648380 1649816 + branched-chain alpha-keto acid dehydrogenase subunit E2 False
VNG2220G lpdA CDS 1448649 chromosome 1649819 1651243 + LpdA False
VNG2349G dppA CDS 1448754 chromosome 1757520 1759496 - hypothetical protein VNG2349G False
VNG2400H CDS 1448792 chromosome 1801477 1802088 + hypothetical protein VNG2400H False
VNG2430G thrC1 CDS 1448815 chromosome 1825082 1826329 - threonine synthase False
VNG2499G gcdH CDS 1448863 chromosome 1866390 1867403 - glutaryl-CoA dehydrogenase False
VNG2603H CDS 1448950 chromosome 1945888 1946232 - hypothetical protein VNG2603H False
VNG2604Gm THI1 CDS 1449073 chromosome 1946319 1947251 + ribulose-1,5-biphosphate synthetase False
VNG2606G thiD CDS 1448951 chromosome 1947251 1948588 + hypothetical protein VNG2606G False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Comments for Module 61

Please add your comments for this module by using the form below. Your comments will be publicly available.

comments powered by Disqus
Social Help

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.