Organism : Bacillus subtilis | Module List :
BSU10370 bioY

biotin transporter (RefSeq)

CircVis
Functional Annotations (1)
Function System
Uncharacterized conserved protein cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU10370
(Mouseover regulator name to see its description)

BSU10370 is regulated by 18 influences and regulates 0 modules.
Regulators for BSU10370 bioY (18)
Regulator Module Operator
BSU00470 79 tf
BSU01010 79 tf
BSU01070 79 tf
BSU01810 79 tf
BSU04100 79 tf
BSU16600 79 tf
BSU19050 79 tf
BSU23210 79 tf
BSU29740 79 tf
BSU34200 79 tf
BSU00470 15 tf
BSU01010 15 tf
BSU01070 15 tf
BSU01080 15 tf
BSU01430 15 tf
BSU04650 15 tf
BSU16600 15 tf
BSU19050 15 tf

Warning: BSU10370 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
4992 1.90e+00 ccATcCtCCtGtTgtTTaCac
Loader icon
4993 6.20e+01 CGGTCTTCCTCCATCCGTTCTCC
Loader icon
5112 2.60e+00 CtCTcgtCCCTcTtT
Loader icon
5113 1.50e+02 CcCggttCaAgcCaagtTgCt
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU10370

BSU10370 is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Uncharacterized conserved protein cog/ cog
Module neighborhood information for BSU10370

BSU10370 has total of 35 gene neighbors in modules 15, 79
Gene neighbors (35)
Gene Common Name Description Module membership
BSU00100 dacA D-alanyl-D-alanine carboxypeptidase (penicillin-binding protein 5) (RefSeq) 79, 234
BSU01070 rpoB DNA-directed RNA polymerase subunit beta (RefSeq) 15, 139
BSU01080 rpoC DNA-directed RNA polymerase subunit beta' (RefSeq) 15, 139
BSU02980 opuAA glycine betaine ABC transporter (ATP-binding protein) (RefSeq) 4, 15
BSU02990 opuAB glycine betaine ABC transporter (permease) (RefSeq) 4, 15
BSU03000 opuAC glycine betaine ABC transporter (glycine betaine-binding lipoprotein) (RefSeq) 4, 15
BSU06360 guaA GMP synthase (RefSeq) 79, 374
BSU06690 gatB aspartyl/glutamyl-tRNA amidotransferase subunit B (RefSeq) 15, 355
BSU10350 yhfS acetyl-CoA acetyltransferase (RefSeq) 15, 79
BSU10360 yhfT acyl-CoA synthetase (RefSeq) 15, 79
BSU10370 bioY biotin transporter (RefSeq) 15, 79
BSU15140 mraW S-adenosyl-methyltransferase MraW (RefSeq) 79, 166
BSU17040 mutS DNA mismatch repair protein MutS (RefSeq) 79, 245
BSU22740 hepT heptaprenyl diphosphate synthase component II (RefSeq) 15, 289
BSU22760 hepS heptaprenyl diphosphate synthase component I (RefSeq) 15, 187
BSU23070 serA D-3-phosphoglycerate dehydrogenase (RefSeq) 15, 128
BSU23670 yqkA hypothetical protein (RefSeq) 11, 79
BSU23680 yqjZ putative degradation enzyme (oxygenase) (RefSeq) 79, 261
BSU23690 yqjY putative acetyltransferase (RefSeq) 11, 79
BSU25260 glyS glycyl-tRNA synthetase subunit beta (RefSeq) 79, 300
BSU25270 glyQ glycyl-tRNA synthetase subunit alpha (RefSeq) 79, 300
BSU27410 alaS alanyl-tRNA synthetase (RefSeq) 79, 158
BSU27850 nadA quinolinate synthetase (RefSeq) 15, 112
BSU27860 nadC nicotinate-nucleotide pyrophosphorylase (RefSeq) 15, 112
BSU27870 nadB L-aspartate oxidase (RefSeq) 15, 112
BSU27880 nifS cysteine desulfurase (RefSeq) 15, 123
BSU27890 nadR transcriptional repressor of de novo NAD biosynthesis (RefSeq) 15, 199
BSU29470 ackA acetate kinase (RefSeq) 62, 79
BSU30530 ytnA putative amino acid permease (RefSeq) 79, 325
BSU33430 yvgQ sulfite reductase subunit beta (RefSeq) 79, 144
BSU33440 cysJ sulfite reductase (flavoprotein alpha-subunit) (RefSeq) 79, 144
BSU38500 dltA D-alanine--poly(phosphoribitol) ligase subunit 1 (RefSeq) 15, 172
BSU38510 dltB putative D-alanine esterase for lipoteichoic acid and wall teichoic acid (RefSeq) 15, 172
BSU38530 dltD putative D-alanine esterase for lipoteichoic acid and wall teichoic acid synthesis (RefSeq) 15, 172
BSU41050 rnpA ribonuclease P (RefSeq) 15, 62
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU10370
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend