Organism : Bacillus subtilis | Module List:
Module 156 Profile

GeneModule member RegulatorRegulator MotifMotif
Network Help

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges.

Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif
Regulators for Module 156

There are 10 regulatory influences for Module 156

Regulator Table (10)
Regulator Name Type
BSU06960 tf
BSU27320 tf
BSU07590 tf
BSU02070 tf
BSU06580 tf
BSU28410 tf
BSU16810 tf
BSU26320 tf
BSU09830 tf
BSU33950 tf

Regulator Help

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type.

tf: Transcription factor

ef: Environmental factor

combiner: Combinatorial influence of a tf or an ef through logic gate. Table is sortable by clicking on the arrows next to column headers.

Motif information (de novo identified motifs for modules)

There are 2 motifs predicted.

Motif Table (2)
Motif Id e-value Consensus Motif Logo
5260 6.30e-08 CcgctttTcC.ttcaccTtTc
Loader icon
5261 7.60e+01 CAGCTGCCACCAAGCCAGATTCCC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment

Regulon 156 is enriched for following functions.

KEGG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini Hochberg pvalue Genes with function Method
Environmental Information Processing kegg category 7.14e-04 4.13e-03 6/24
Membrane Transport kegg subcategory 1.55e-02 3.21e-02 3/24
ABC transporters kegg pathway 6.12e-03 1.64e-02 3/24
Signal Transduction kegg subcategory 3.48e-03 1.15e-02 3/24
Two-component system kegg pathway 3.48e-03 1.15e-02 3/24

COG Enrichment Table

Function Name Function Type Unadjusted pvalue Benjamini& Hochberg pvalue Genes with function Method
Signal transduction mechanisms cog subcategory 1.21e-02 1.92e-02 3/24
Carbohydrate transport and metabolism cog subcategory 4.39e-03 7.36e-03 5/24
Function unknown cog subcategory 9.90e-03 1.60e-02 5/24
Functions Help

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Members for Module 156

There are 24 genes in Module 156

Gene Member Table (24)
Name Common name Type Gene ID Chromosome Start End Strand Description TF
BSU03110 ycgH CDS None chromosome 335684 336817 - putative amino acid transporter (RefSeq) False
BSU03120 ycgI CDS None chromosome 336984 337718 + putative methyltransferase (RefSeq) False
BSU03680 yclG CDS None chromosome 417561 419315 + putative uronase (RefSeq) False
BSU06920 yesJ CDS None chromosome 756448 756990 + putative acetyltransferase (RefSeq) False
BSU06930 yesK CDS None chromosome 756926 757315 + putative permease (RefSeq) False
BSU06960 yesN CDS None chromosome 759789 760895 + two-component response regulator [YesM] (RefSeq) True
BSU07270 yfnH CDS None chromosome 797806 798570 + putative sugar-phosphate cytidylyltransferase (RefSeq) False
BSU07580 citS CDS None chromosome 830282 831910 + two-component sensor histidine kinase (RefSeq) False
BSU07590 citT CDS None chromosome 831882 832562 + two-component response regulator (RefSeq) True
BSU07600 yflP CDS None chromosome 832745 833524 + hypothetical protein (RefSeq) False
BSU13710 ykvI CDS None chromosome 1437400 1438443 + putative transporter (RefSeq) False
BSU15650 yloB CDS None chromosome 1637265 1639937 + P-type calcium transport ATPase (RefSeq) False
BSU18270 ynzE CDS None chromosome 1956660 1956965 - hypothetical protein (RefSeq) False
BSU28380 gerM CDS None chromosome 2901068 2902168 - germination (cortex hydrolysis) and sporulation (stage II, multiple polar septa) lytic enzyme (RefSeq) False
BSU31220 yuxG CDS None chromosome 3200899 3202968 - short chain dehydrogenase (RefSeq) False
BSU34120 ganB CDS None chromosome 3500682 3501971 - secreted arabinogalactan oligomer endo-hydrolase (RefSeq) False
BSU34140 ganQ CDS None chromosome 3504133 3504984 - arabinogalactan oligomer permease (RefSeq) False
BSU34150 ganP CDS None chromosome 3504988 3506244 - arabinogalactan oligomer permease (RefSeq) False
BSU34160 cycB CDS None chromosome 3506284 3507549 - cyclodextrin-binding lipoprotein (RefSeq) False
BSU38990 scoA CDS None chromosome 4000994 4001710 - succinyl CoA:3-oxoacid CoA-transferase (subunit A) (RefSeq) False
BSU39000 yxjC CDS None chromosome 4001734 4003152 - putative permease (RefSeq) False
BSU39860 aldX CDS None chromosome 4093000 4094337 + putative aldehyde dehydrogenase (RefSeq) False
BSU40430 yycE CDS None chromosome 4155955 4156374 - hypothetical protein (RefSeq) False
BSU40940 yyaD CDS None chromosome 4202448 4203464 - putative integral membrane protein; putative transporter (RefSeq) False

Genes Help

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Help

What is a module?

Regulatory units (modules) in the Network Portal are based on the network inference algorithm used. For the current version, modules are based on cMonkey modules and Inferelator regulatory influences on these modules. More specifically, module refers to set of genes that are conditionally co-regulated under subset of the conditions. Identification of modules integrates co-expression, de-novo motif identification, and other functional associations such as operon information and protein-protein interactions.

Module Overview

The landing module page shows quick summary info including co-expression profiles, de-novo identified motifs, and transcription factors and/or environmental factors as regulatory influences. It also includes module residual, motif e-values, conditions and links to other resources such as NCBI and Microbesonline. . If a transcription factor is included in the manually curated RegPrecise database, further information from RegPrecise is shown, allowing users to perform comparative analysis.

Expression Profiles

Expression profiles is a plot of the expression ratios (log10) of the module's genes, over all subset of the conditions included in the module. The X-axis represent conditions and the Y-axis represents log10 expression ratios. Each gene is plotted as line plot with different colors. Colored legend for the lines are presented under the plot. This plot is dynamic. Clicking on the gene names in the legend will show/hide the plot for that particular gene. A tooltip will show expression ratio information if you mouseover the lines in the plot.

Motif Locations

Location of the Identified motifs for the module in the upstream regions of the member genes are shown under the expression profiles plot. This plot shows the diagram of the upstream positions of the motifs, colored red and green for motifs #1, and 2, respectively. Intensity of the color is proportional to the significance of the occurence of that motif at a given location. Motifs on the forward and reverse strand are represented over and under the line respectively.

Network

A network view of the module is created using cytoscapeWeb and enables dynamic, interactive exploration of the module properties. In this view, module member genes, motifs, and regulatory influences are represented as peripheral nodes connected to core module node via edges. Module members are green circles, regulators are red triangles and motifs are blue diamonds. Selection of a node gives access to detailed information in a pop-up window, which allows dragging and pinning to compare multiple selections. Selecting module members will show information about the selected gene such as name, species and fucntions. Motif selection will show motif logo image and e-values. Bicluster selction will show expression profile and summary statistics for the module.

GeneModule member RegulatorRegulator MotifMotif

Regulators

For each module, single or AND logic connected regulatory influences are listed under the regulators tab. These regulatory influences are identified by Inferelator. Table shows name of the regulator and its type. tf: Transcription factor, ef: Environmental factor and combiner:Combinatorial influence of a tf or an ef through logic gate. Tabel is sortable by clicking on the arrows next to column headers.

Motifs

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Functions

Biological networks contain sets of regulatory units called functional modules that together play a role in regulation of specific functional processes. Connections between different modules in the network can help identify regulatory relationships such as hierarchy and epistasis. In addition, associating functions with modules enables putative assignment of functions to hypothetical genes. It is therefore essential to identify functional enrichment of modules within the regulatory network.

Functional annotations from single sources are often either not available or not complete. Therefore, we integrated KEGG pathway, Gene Ontology, TIGRFam and COG information as references for functional enrichment analysis.

We use hypergeometric p-values to identify significant overlaps between co-regulated module members and genes assigned to a particular functional annotation category. P-values are corrected for multiple comparisons by using Benjamini-Hochberg correction and filtered for p-values ≤ 0.05.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Genes

Gene member table shows all the genes included in the module. Listed attributes are;

  1. Name: Gene name or Locus tag
  2. Common Name: Gene short name
  3. Type: Type of the feature, usually CDS.
  4. Gene ID: Link to NCBI Gene ID
  5. Chromosome: Chromosome name from annotation file
  6. Start/End:Feature start and end coordinates
  7. Strand: strand of the gene
  8. Description: Description of the gene from annotation file
  9. TF: If the gene is a Transcription Factor or not.

If you are browsing the Network Portal by using Gaggle/Firegoose, firegoose plugin will capture the NameList of the gene members. Captured names can be saved into your Workspace by clicking on "Capture" in the firegoose toolbar or can be directly sent other desktop and web resources by using "Broadcast" option.

Social

You can start a conversation about this module or join the existing discussion by adding your comments. In order to be able to add your comments you need to sign in by using any of the following services;Disqus, Google, Facebook or Twitter. For full compatibility with other network portal features, we recommend using your Google ID.

Definitions

Residual: is a measure of bicluster quality. Mean bicluster residual is smaller when the expression profile of the genes in the module is "tighter". So smaller residuals are usually indicative of better bicluster quality.

Expression Profile: is a preview of the expression profiles of all the genes under subset of conditions included in the module. Tighter expression profiles are usually indicative of better bicluster quality.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Genes: Number of genes included in the module.

Functions: We identify functional enrichment of each module by camparing to different functional categories such as KEGG, COG, GO etc. by using hypergeometric function. If the module is significantly enriched for any of the functions, this column will list few of the these functions as an overview. Full list of functions is available upon visiting the module page under the Functions tab.