Organism : Clostridium acetobutylicum | Module List :
CAC0387

Hypothetical protein (NCBI ptt file)

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for CAC0387
(Mouseover regulator name to see its description)

CAC0387 is regulated by 24 influences and regulates 0 modules.
Regulators for CAC0387 (24)
Regulator Module Operator
CAC0289 324 tf
CAC0382 324 tf
CAC0571 324 tf
CAC0933 324 tf
CAC2254 324 tf
CAC2306 324 tf
CAC2307 324 tf
CAC3283 324 tf
CAC3399 324 tf
CAC3409 324 tf
CAC3677 324 tf
CAC0078 285 tf
CAC0191 285 tf
CAC1467 285 tf
CAC1578 285 tf
CAC1695 285 tf
CAC2060 285 tf
CAC2209 285 tf
CAC2254 285 tf
CAC2306 285 tf
CAC2307 285 tf
CAC2773 285 tf
CAC3271 285 tf
CAC3409 285 tf

Warning: CAC0387 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
7222 1.80e+00 aAgggtGcaaaaGt
Loader icon
7223 2.10e+03 GCTTATCCTTTTACTTAAAGCC
Loader icon
7300 5.00e-03 aGGaGG
Loader icon
7301 3.10e+00 acTa.gcTtTTAttTTAAag
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for CAC0387

Warning: No Functional annotations were found!

Module neighborhood information for CAC0387

CAC0387 has total of 37 gene neighbors in modules 285, 324
Gene neighbors (37)
Gene Common Name Description Module membership
CAC0058 CAC0058 Hypothetical protein (NCBI ptt file) 21, 324
CAC0073 CAC0073 Uncharacterized protein, ortholog of YYBG B.subtilis (NCBI ptt file) 264, 324
CAC0117 121 protein cheY homolog (NCBI ptt file) 107, 285
CAC0121 cheR Chemotaxis protein methyltransferase (cheR) (NCBI ptt file) 100, 324
CAC0152 CAC0152 Ribosomal-protein-alanine acetyltransferase (acetylating enzyme for N-terminal of ribosomal protein S5) (NCBI ptt file) 265, 285
CAC0311 CAC0311 PolyA polymerase (NCBI ptt file) 285, 355
CAC0382 levR Possible transcriptional regulator of levanase operon, AAA-ATPase domain (NtrC family), fused to 2 BglG-like domains, ortholog of B.subtilis levR (NCBI ptt file) 324, 332
CAC0383 CAC0383 PTS cellobiose-specific component IIA (NCBI ptt file) 28, 324
CAC0384 licB PTS system, cellobiose-specific component BII (NCBI ptt file) 285, 324
CAC0385 CAC0385 Beta-glucosidase (NCBI ptt file) 285, 324
CAC0386 licC PTS cellobiose-specific component IIC (NCBI ptt file) 82, 285
CAC0387 CAC0387 Hypothetical protein (NCBI ptt file) 285, 324
CAC0533 glvA Maltose-6'-phosphate glucosidase (glvA) (NCBI ptt file) 284, 324
CAC0540 CAC0540 Beta-mannanase ManB-like enzyme, contains ChW-repeats (NCBI ptt file) 264, 324
CAC0542 CAC0542 Methyl-accepting chemotaxis protein (NCBI ptt file) 70, 285
CAC0644 gerKA Spore germination protein gerKA (NCBI ptt file) 324, 360
CAC0741 CAC0741 Methyl-accepting chemotaxis protein (NCBI ptt file) 24, 285
CAC0908 CAC0908 Dinucleotide-utilizing enzyme involved in molybdopterin and thiamine biosynthesis family 1 (NCBI ptt file) 217, 324
CAC1233 chev Chemotaxis protein CheV ortholog (CheW-like adaptor domain and CheY-like reciever domain) (NCBI ptt file) 93, 285
CAC1433 CAC1433 Hypothetical protein (NCBI ptt file) 285, 319
CAC2154 flgE Flagellar hook protein FlgE. (NCBI ptt file) 96, 285
CAC2194 CAC2194 Predicted nucleoside-diphosphate sugar epimerase (NCBI ptt file) 96, 285
CAC2254 CAC2254 Response regulator (CheY-like receiver domain and HTH-type DNA-binding domain) (NCBI ptt file) 100, 285
CAC2338 CAC2338 Lysine decarboxylase (NCBI ptt file) 82, 285
CAC2488 CAC2488 Uncharacterized conserved protein, YTFE family (NCBI ptt file) 285, 367
CAC2740 hisS Histidyl-tRNA synthetase (NCBI ptt file) 84, 324
CAC3156 CAC3156 Uncharacterized conserved protein, YACZ B.subtilis ortholog (NCBI ptt file) 84, 324
CAC3271 CAC3271 Transcriptional regulator, AcrR family (NCBI ptt file) 223, 285
CAC3272 CAC3272 Possible surface protein, responsible for cell interaction; contains cell adhesion domain and ChW-repeats (NCBI ptt file) 285, 359
CAC3281 CAC3281 ABC-type multidrug/protein/lipid transport system, ATPase component (NCBI ptt file) 84, 324
CAC3282 CAC3282 ABC-type multidrug/protein/lipid transport system, ATPase component (NCBI ptt file) 9, 324
CAC3283 CAC3283 Transcriptional regulator, MarR/EmrR family (NCBI ptt file) 9, 324
CAC3333 CAC3333 Uncharacterized conserved protein, related to pyruvate formate-lyase activating enzyme (NCBI ptt file) 265, 285
CAC3397 CAC3397 Membrane associated methyl-accepting chemotaxis protein (with HAMP domain) (NCBI ptt file) 324, 338
CAC3398 CAC3398 Uncharacterized conserved protein, YbhB family (NCBI ptt file) 108, 324
CAC3399 CAC3399 Predicted transcriptional regulator (NCBI ptt file) 108, 324
CAC3721 CAC3721 Hypothetical secreted protein (NCBI ptt file) 84, 324
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for CAC0387
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend