Organism : Clostridium acetobutylicum | Module List :
CAC0386 licC

PTS cellobiose-specific component IIC (NCBI ptt file)

CircVis
Functional Annotations (7)
Function System
Phosphotransferase system cellobiose-specific component IIC cog/ cog
sugar:hydrogen symporter activity go/ molecular_function
protein-N(PI)-phosphohistidine-sugar phosphotransferase activity go/ molecular_function
protein-N(PI)-phosphohistidine-sugar phosphotransferase complex go/ cellular_component
phosphoenolpyruvate-dependent sugar phosphotransferase system go/ biological_process
integral to membrane go/ cellular_component
lacE tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for CAC0386
(Mouseover regulator name to see its description)

CAC0386 is regulated by 28 influences and regulates 0 modules.
Regulators for CAC0386 licC (28)
Regulator Module Operator
CAC0078 285 tf
CAC0191 285 tf
CAC1467 285 tf
CAC1578 285 tf
CAC1695 285 tf
CAC2060 285 tf
CAC2209 285 tf
CAC2254 285 tf
CAC2306 285 tf
CAC2307 285 tf
CAC2773 285 tf
CAC3271 285 tf
CAC3409 285 tf
CAC0191 82 tf
CAC0201 82 tf
CAC0569 82 tf
CAC0841 82 tf
CAC0849 82 tf
CAC1467 82 tf
CAC1559 82 tf
CAC1578 82 tf
CAC1766 82 tf
CAC1869 82 tf
CAC2060 82 tf
CAC2084 82 tf
CAC2690 82 tf
CAC3037 82 tf
CAC3192 82 tf

Warning: CAC0386 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
6818 3.00e-06 GgAgGg
Loader icon
6819 8.90e+03 CTGCTGC
Loader icon
7222 1.80e+00 aAgggtGcaaaaGt
Loader icon
7223 2.10e+03 GCTTATCCTTTTACTTAAAGCC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for CAC0386

CAC0386 is enriched for 7 functions in 3 categories.
Module neighborhood information for CAC0386

CAC0386 has total of 41 gene neighbors in modules 82, 285
Gene neighbors (41)
Gene Common Name Description Module membership
CAC0040 CAC0040 Uncharacterized small conserved protein, homolog of yfjA/yukE B.subtilis (NCBI ptt file) 82, 251
CAC0117 121 protein cheY homolog (NCBI ptt file) 107, 285
CAC0152 CAC0152 Ribosomal-protein-alanine acetyltransferase (acetylating enzyme for N-terminal of ribosomal protein S5) (NCBI ptt file) 265, 285
CAC0168 CAC0168 T-RNA-processing ribonuclease BN (NCBI ptt file) 82, 207
CAC0208 CAC0208 Predicted membrane protein; CF-20 family (NCBI ptt file) 82, 302
CAC0209 CAC0209 Predicted membrane protein; CF-20 family (NCBI ptt file) 82, 366
CAC0290 CAC0290 Sensory transduction histidine kinases (NCBI ptt file) 82, 91
CAC0311 CAC0311 PolyA polymerase (NCBI ptt file) 285, 355
CAC0384 licB PTS system, cellobiose-specific component BII (NCBI ptt file) 285, 324
CAC0385 CAC0385 Beta-glucosidase (NCBI ptt file) 285, 324
CAC0386 licC PTS cellobiose-specific component IIC (NCBI ptt file) 82, 285
CAC0387 CAC0387 Hypothetical protein (NCBI ptt file) 285, 324
CAC0539 manB Beta-mannanase ManB, contains ChW-repeats (NCBI ptt file) 82, 251
CAC0542 CAC0542 Methyl-accepting chemotaxis protein (NCBI ptt file) 70, 285
CAC0630 CAC0630 Peptide chain ralease factor 3 (RF-3) (NCBI ptt file) 82, 160
CAC0633 CAC0633 Predicted phosphatase (NCBI ptt file) 82, 151
CAC0741 CAC0741 Methyl-accepting chemotaxis protein (NCBI ptt file) 24, 285
CAC0783 CAC0783 Uncharacterized low-complexity protein (NCBI ptt file) 82, 251
CAC0784 CAC0784 ATP-dependent RNA helicase, superfamily II (NCBI ptt file) 82, 251
CAC1233 chev Chemotaxis protein CheV ortholog (CheW-like adaptor domain and CheY-like reciever domain) (NCBI ptt file) 93, 285
CAC1433 CAC1433 Hypothetical protein (NCBI ptt file) 285, 319
CAC1615 CAC1615 Predicted glycosyltransferase (NCBI ptt file) 69, 82
CAC2154 flgE Flagellar hook protein FlgE. (NCBI ptt file) 96, 285
CAC2174 CAC2174 Glycosyltransferase (NCBI ptt file) 82, 346
CAC2194 CAC2194 Predicted nucleoside-diphosphate sugar epimerase (NCBI ptt file) 96, 285
CAC2253 CAC2253 Membrane-associated sensory histidine kinase-like ATPase (NCBI ptt file) 82, 106
CAC2254 CAC2254 Response regulator (CheY-like receiver domain and HTH-type DNA-binding domain) (NCBI ptt file) 100, 285
CAC2323 CAC2323 Predicted membrane protein (NCBI ptt file) 5, 82
CAC2324 CAC2324 Glycosyltransferase (NCBI ptt file) 82, 215
CAC2338 CAC2338 Lysine decarboxylase (NCBI ptt file) 82, 285
CAC2432 CAC2432 Predicted permease (NCBI ptt file) 82, 106
CAC2488 CAC2488 Uncharacterized conserved protein, YTFE family (NCBI ptt file) 285, 367
CAC2601 CAC2601 S-adenosylmethionine decarboxylase (NCBI ptt file) 82, 225
CAC2912 araN Sugar-binding periplasmic protein (NCBI ptt file) 82, 235
CAC2913 CAC2913 Hypothetical protein (NCBI ptt file) 82, 235
CAC3212 CAC3212 Fusion of Uroporphyrinogen-III methylase related protein and MAZG family protein, YABN B.subtilis ortholog (NCBI ptt file) 82, 302
CAC3260 asnS Aspartyl/asparaginyl-tRNA synthetase (NCBI ptt file) 82, 292
CAC3271 CAC3271 Transcriptional regulator, AcrR family (NCBI ptt file) 223, 285
CAC3272 CAC3272 Possible surface protein, responsible for cell interaction; contains cell adhesion domain and ChW-repeats (NCBI ptt file) 285, 359
CAC3333 CAC3333 Uncharacterized conserved protein, related to pyruvate formate-lyase activating enzyme (NCBI ptt file) 265, 285
CAC3668 CAC3668 MDR-type permease (NCBI ptt file) 82, 251
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for CAC0386
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend