Organism : Halobacterium salinarum NRC-1 | Module List :
VNG1779C

hypothetical protein VNG1779C

CircVis
Functional Annotations (6)
Function System
Undecaprenyl pyrophosphate synthase cog/ cog
metabolic process go/ biological_process
di-trans,poly-cis-decaprenylcistransferase activity go/ molecular_function
Terpenoid backbone biosynthesis kegg/ kegg pathway
Biosynthesis of secondary metabolites kegg/ kegg pathway
uppS tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG1779C
(Mouseover regulator name to see its description)

VNG1779C is regulated by 11 influences and regulates 0 modules.
Regulators for VNG1779C (11)
Regulator Module Operator
VNG1510C 131 tf
VNG6143H 131 tf
VNG1179C 230 tf
VNG1616C 230 tf
VNG1548C 44 tf
VNG1616C
VNG0389C
44 combiner
VNG1886C 44 tf
VNG6143H 44 tf
VNG1548C 234 tf
VNG1616C
VNG0389C
234 combiner
VNG1886C 234 tf

Warning: VNG1779C Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
1065 3.40e+03 taagctCca.accCGGcAcat
Loader icon
1066 8.30e+03 ccGCgAAcaaC
Loader icon
1235 1.10e+03 CgaCca..ACgCggAa.cC
Loader icon
1236 4.90e+03 CTTTTA
Loader icon
1399 1.90e-03 ACTCcCaCGTaacAcaCaTCa
Loader icon
1400 1.10e-03 ACcaaaGcCCGAcACACcGcACaC
Loader icon
1405 3.00e+01 CAgcgAacagaAaGCaCatACGt
Loader icon
1406 3.00e+02 ACCAAGAGACGACAGCACTCT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG1779C

VNG1779C is enriched for 6 functions in 3 categories.
Enrichment Table (6)
Function System
Undecaprenyl pyrophosphate synthase cog/ cog
metabolic process go/ biological_process
di-trans,poly-cis-decaprenylcistransferase activity go/ molecular_function
Terpenoid backbone biosynthesis kegg/ kegg pathway
Biosynthesis of secondary metabolites kegg/ kegg pathway
uppS tigr/ tigrfam
Module neighborhood information for VNG1779C

VNG1779C has total of 25 gene neighbors in modules 44, 131, 230, 234
Gene neighbors (25)
Gene Common Name Description Module membership
VNG0761G dip3 competence-damage protein CinA-like 44, 151, 214
VNG0854C hypothetical protein VNG0854C 44
VNG0857Cm RNA methylase 44, 88
VNG1235C hypothetical protein VNG1235C 131, 285
VNG1237C hypothetical protein VNG1237C 116, 131
VNG1238C hypothetical protein VNG1238C 230
VNG1239H hypothetical protein VNG1239H 117, 230
VNG1240G yhdG amino acid transporter 230
VNG1287C hypothetical protein VNG1287C 131, 160
VNG1777H hypothetical protein VNG1777H 192, 230, 234
VNG1779C hypothetical protein VNG1779C 44, 131, 230, 234
VNG1784C DNA primase 28, 42, 68, 83, 234
VNG1795C hypothetical protein VNG1795C 131
VNG1818G idi Idi 68, 86, 209, 214, 234, 257
VNG1967G glpK hypothetical protein VNG1967G 44
VNG1969G gpdA2 glycerol-3-phosphate dehydrogenase chain A 44
VNG1971G gpdB anaerobic glycerol-3-phosphate dehydrogenase subunit B 20, 44
VNG2452C hypothetical protein VNG2452C 234
VNG2501C hypothetical protein VNG2501C 68, 214, 234
VNG2669G cyo cytochrome oxidase subunit I-like protein 44, 179
VNG5175H None 42, 68, 234
VNG6191H hypothetical protein VNG6191H 17, 30, 34, 38, 41, 44, 80, 91
VNG6193H hypothetical protein VNG6193H 17, 32, 34, 38, 41, 42, 44, 80
VNG6384H hypothetical protein VNG6384H 20, 131, 160, 232
VNG7121 hypothetical protein VNG7121 234
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG1779C
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend