Organism : Methanococcus maripaludis S2
| Module List :
MMP0319 cbiL
precorrin-2 C-20 methyltransferase
Functional Annotations (7)
| Function | System |
|---|---|
| Precorrin-2 methylase | cog/ cog |
| cobalamin biosynthetic process | go/ biological_process |
| precorrin-2 C20-methyltransferase activity | go/ molecular_function |
| cobalt-factor II C20-methyltransferase activity | go/ molecular_function |
| Porphyrin and chlorophyll metabolism | kegg/ kegg pathway |
| Metabolic pathways | kegg/ kegg pathway |
| cobI_cbiL | tigr/ tigrfam |
Regulation information for MMP0319
(Mouseover regulator name to see its description)
| Regulator | Module | Operator |
|---|---|---|
| MMP0033 H2 |
140 | combiner |
| MMP0033 MMP0629 |
140 | combiner |
| MMP0052 MMP0257 |
140 | combiner |
| MMP0637 | 140 | tf |
| MMP1467 MMP1646 |
140 | combiner |
| MMP0033 | 149 | tf |
| MMP0052 MMP0480 |
149 | combiner |
| MMP0607 | 149 | tf |
| MMP0637 MMP0678 |
149 | combiner |
| MMP1467 MMP1646 |
149 | combiner |
| MMP1704 | 149 | tf |
| MMP0033 | 141 | tf |
| MMP0607 | 141 | tf |
| MMP0907 MMP1646 |
141 | combiner |
| MMP1704 | 141 | tf |
| MMP0907 MMP1646 |
24 | combiner |
| MMP1065 | 24 | tf |
| MMP1499 MMP1646 |
24 | combiner |
| MMP1704 | 24 | tf |
Motif information (de novo identified motifs for modules)
There are 8 motifs predicted.
| Motif Id | e-value | Consensus | Motif Logo |
|---|---|---|---|
| 709 | 4.70e-04 | taCCaCCa |
![]() |
| 710 | 4.30e+03 | GCGAGGG |
![]() |
| 931 | 1.10e-02 | aTCTGGTG |
![]() |
| 932 | 1.10e+02 | GGGTTCAAATCCCcccCacaGCGC |
![]() |
| 933 | 7.10e+01 | ATctctAtTcTttacATtcc |
![]() |
| 934 | 6.20e+03 | GCAAATCATATTTGGTTTCATAC |
![]() |
| 947 | 6.00e-01 | taTTaa.cggtGgt |
![]() |
| 948 | 1.50e+02 | tCTgtcc.tct.gga.gcat |
![]() |
Functional Enrichment for MMP0319
| Function | System |
|---|---|
| Precorrin-2 methylase | cog/ cog |
| cobalamin biosynthetic process | go/ biological_process |
| precorrin-2 C20-methyltransferase activity | go/ molecular_function |
| cobalt-factor II C20-methyltransferase activity | go/ molecular_function |
| Porphyrin and chlorophyll metabolism | kegg/ kegg pathway |
| Metabolic pathways | kegg/ kegg pathway |
| cobI_cbiL | tigr/ tigrfam |
Module neighborhood information for MMP0319
| Gene | Common Name | Description | Module membership |
|---|---|---|---|
| MMP0034 | GTP cyclohydrolase | 130, 149 | |
| MMP0046 | hypothetical protein MMP0046 | 20, 51, 140 | |
| MMP0074 | hypothetical protein MMP0074 | 51, 140 | |
| MMP0076 | deoxyribonuclease | 24, 35 | |
| MMP0106 | hypothetical protein MMP0106 | 107, 140 | |
| MMP0133 | guaB | inosine-5'-monophosphate dehydrogenase | 25, 120, 140 |
| MMP0134 | hypothetical protein MMP0134 | 24, 92 | |
| MMP0137 | dys | putative deoxyhypusine synthase | 25, 141, 149 |
| MMP0210 | hypothetical protein MMP0210 | 58, 140 | |
| MMP0220 | Sodium/proline symporter-related | 70, 140 | |
| MMP0224 | hemL | glutamate-1-semialdehyde aminotransferase | 60, 130, 140 |
| MMP0282 | purE | phosphoribosylaminoimidazole carboxylase catalytic subunit | 7, 140 |
| MMP0284 | infB | translation initiation factor IF-2 | 25, 149 |
| MMP0319 | cbiL | precorrin-2 C-20 methyltransferase | 24, 140, 141, 149 |
| MMP0320 | shikimate kinase | 47, 141 | |
| MMP0340 | pycB | pyruvate carboxylase subunit B | 24, 86, 120, 141, 149 |
| MMP0346 | 2-hydroxyglutaryl-CoA dehydratase subunit D-like protein | 7, 140 | |
| MMP0356 | group 1 glycosyl transferase | 80, 139, 140 | |
| MMP0415 | O-sialoglycoprotein endopeptidase/protein kinase | 47, 149 | |
| MMP0419 | sodium:neurotransmitter symporter | 24, 38 | |
| MMP0530 | hypothetical protein MMP0530 | 92, 140 | |
| MMP0531 | hypothetical protein MMP0531 | 106, 140 | |
| MMP0541 | serB | phosphoserine phosphatase SerB | 7, 40, 139, 140 |
| MMP0550 | amino acid ABC transporter periplasmic protein | 81, 140 | |
| MMP0554 | SAM-binding motif-containing protein | 129, 140 | |
| MMP0564 | hypothetical protein MMP0564 | 111, 149 | |
| MMP0588 | dph5 | diphthine synthase | 25, 81, 140 |
| MMP0609 | pth2 | peptidyl-tRNA hydrolase | 66, 140 |
| MMP0637 | ArsR family transcriptional regulator | 24, 107 | |
| MMP0655 | hypothetical protein MMP0655 | 24, 38, 52 | |
| MMP0679 | Na+/H+ antiporter-like protein | 24, 38 | |
| MMP0694 | beta-lactamase-like protein | 51, 109, 149 | |
| MMP0702 | hypothetical protein MMP0702 | 24, 38, 162 | |
| MMP0705 | wbpI | UDP-N-acetylglucosamine 2-epimerase | 80, 140 |
| MMP0707 | sodium/hydrogen exchanger | 87, 109, 140 | |
| MMP0713 | iorA2 | indolepyruvate oxidoreductase subunit alpha 2 | 24, 47, 86 |
| MMP0714 | iorB2 | indolepyruvate oxidoreductase subunit beta | 24, 47, 86 |
| MMP0715 | coenzyme F390 synthetase II | 24, 86 | |
| MMP0814 | hypothetical protein MMP0814 | 24, 86 | |
| MMP0815 | hypothetical protein MMP0815 | 24, 86 | |
| MMP0865 | aminotransferase (subgroup II) adenosylmethionine-8-amino-7-oxononanoate aminotransferase | 115, 140 | |
| MMP0878 | ribonuclease P-like protein | 25, 87, 140 | |
| MMP0880 | aksF | isopropylmalate/isohomocitrate dehydrogenase | 24, 60, 140, 143 |
| MMP0905 | hypothetical protein MMP0905 | 14, 149 | |
| MMP0906 | ribonuclease Z | 129, 149 | |
| MMP0907 | transcriptional regulator TrmB | 14, 149 | |
| MMP0919 | dihydroorotate dehydrogenase electron transfer subunit | 86, 141 | |
| MMP0920 | ahcY | S-adenosyl-L-homocysteine hydrolase | 80, 141 |
| MMP0921 | RNAse P, Rpr2/Rpp21 subunit | 25, 141 | |
| MMP0941 | hypothetical protein MMP0941 | 129, 149 | |
| MMP0953 | cbiH | precorrin-3B C17-methyltransferase | 24, 25, 149 |
| MMP0989 | top6B | DNA topoisomerase VI subunit B | 139, 141 |
| MMP0999 | hypothetical protein MMP0999 | 95, 140 | |
| MMP1014 | radical SAM domain-containing protein | 25, 141 | |
| MMP1017 | lysC | aspartate kinase | 24, 60, 112 |
| MMP1068 | K+-dependent Na+/Ca+ exchanger related-protein:Sodium/calcium exchanger membrane region | 81, 140 | |
| MMP1085 | hypothetical protein MMP1085 | 141, 143, 149 | |
| MMP1086 | hypothetical protein MMP1086 | 122, 141 | |
| MMP1106 | hypothetical protein MMP1106 | 81, 137, 140 | |
| MMP1107 | Signal recognition particle protein SRP19 | 111, 141 | |
| MMP1108 | corA | magnesium/cobalt transporter CorA | 141, 149 |
| MMP1112 | hypothetical protein MMP1112 | 111, 129, 141, 149 | |
| MMP1270 | bifunctional hexulose-6-phosphate synthase/ribonuclease regulator | 24, 38 | |
| MMP1307 | methyltransferase-like protein | 4, 149 | |
| MMP1312 | hypothetical protein MMP1312 | 52, 140 | |
| MMP1313 | fen-1 | flap endonuclease-1 | 47, 52, 141 |
| MMP1326 | rpoN | DNA-directed RNA polymerase subunit N | 103, 118, 140 |
| MMP1327 | rpoK | RNA polymerase Rpb6 | 103, 139, 149 |
| MMP1328 | enolase | 103, 139, 149 | |
| MMP1353 | hypothetical protein MMP1353 | 81, 140 | |
| MMP1356 | PP-loop domain-containing protein | 25, 129, 139, 140, 149 | |
| MMP1357 | hypothetical protein MMP1357 | 140, 149 | |
| MMP1361 | rpoB2 | DNA-directed RNA polymerase subunit beta'' | 25, 92, 109, 149 |
| MMP1362 | rpoB1 | DNA-directed RNA polymerase subunit B' | 63, 130, 140 |
| MMP1363 | rpoA1 | DNA-directed RNA polymerase subunit A' | 24, 103, 130 |
| MMP1425 | tRNA 2'-O-methylase | 25, 87, 140 | |
| MMP1426 | dcd | bifunctional dCTP deaminase/dUTP diphosphatase | 16, 112, 140 |
| MMP1438 | hypothetical protein MMP1438 | 14, 140 | |
| MMP1491 | trzA | amidohydrolase | 14, 111, 122, 149 |
| MMP1492 | pyrE | orotate phosphoribosyltransferase | 14, 149 |
| MMP1537 | cytochrome c heme-binding site | 24, 29 | |
| MMP1538 | transporter component | 24, 29 | |
| MMP1540 | hypothetical protein MMP1540 | 24, 140 | |
| MMP1541 | hypothetical protein MMP1541 | 24, 38 | |
| MMP1582 | pdaD | pyruvoyl-dependent arginine decarboxylase | 87, 149 |
| MMP1590 | ExsB family protein | 24, 51 | |
| MMP1614 | hisS | histidyl-tRNA synthetase | 141, 149 |
| MMP1659 | pyrB | aspartate carbamoyltransferase catalytic subunit | 24, 111, 122 |
| Unanno_2 | None | 24, 86 | |
| Unanno_4 | None | 24, 86 |
Gene Page Help
Network Tab
If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.
Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.
Regulation Tab
Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.
If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.
You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".
For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.
Motifs Tab
Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.
Functions Tab
Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.
Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.
Module Members Tab
Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.
Help Tab
This help page. More general help can be accessed by clicking help menu in the main navigation bar.
CircVis
Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
- 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
- 2. Source gene
- 3. Target genes (other module members)
- 4. Interactions between source and target genes for a particular module
- 5. Module(s) that source gene and target genes belong to
- 6. Visualisation legend


Module member
Regulator
Motif 

Social Tab
Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.
Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.
In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.