Organism : Methanococcus maripaludis S2 | Module List :
MMP0319 cbiL

precorrin-2 C-20 methyltransferase

CircVis
Functional Annotations (7)
Function System
Precorrin-2 methylase cog/ cog
cobalamin biosynthetic process go/ biological_process
precorrin-2 C20-methyltransferase activity go/ molecular_function
cobalt-factor II C20-methyltransferase activity go/ molecular_function
Porphyrin and chlorophyll metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
cobI_cbiL tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for MMP0319
(Mouseover regulator name to see its description)

MMP0319 is regulated by 19 influences and regulates 0 modules.
Regulators for MMP0319 cbiL (19)
Regulator Module Operator
MMP0907
MMP1646
24 combiner
MMP1065 24 tf
MMP1499
MMP1646
24 combiner
MMP1704 24 tf
MMP0033 149 tf
MMP0052
MMP0480
149 combiner
MMP0607 149 tf
MMP0637
MMP0678
149 combiner
MMP1467
MMP1646
149 combiner
MMP1704 149 tf
MMP0033
H2
140 combiner
MMP0033
MMP0629
140 combiner
MMP0052
MMP0257
140 combiner
MMP0637 140 tf
MMP1467
MMP1646
140 combiner
MMP0033 141 tf
MMP0607 141 tf
MMP0907
MMP1646
141 combiner
MMP1704 141 tf

Warning: MMP0319 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
709 4.70e-04 taCCaCCa
Loader icon
710 4.30e+03 GCGAGGG
Loader icon
931 1.10e-02 aTCTGGTG
Loader icon
932 1.10e+02 GGGTTCAAATCCCcccCacaGCGC
Loader icon
933 7.10e+01 ATctctAtTcTttacATtcc
Loader icon
934 6.20e+03 GCAAATCATATTTGGTTTCATAC
Loader icon
947 6.00e-01 taTTaa.cggtGgt
Loader icon
948 1.50e+02 tCTgtcc.tct.gga.gcat
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for MMP0319

MMP0319 is enriched for 7 functions in 3 categories.
Enrichment Table (7)
Function System
Precorrin-2 methylase cog/ cog
cobalamin biosynthetic process go/ biological_process
precorrin-2 C20-methyltransferase activity go/ molecular_function
cobalt-factor II C20-methyltransferase activity go/ molecular_function
Porphyrin and chlorophyll metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
cobI_cbiL tigr/ tigrfam
Module neighborhood information for MMP0319

MMP0319 has total of 90 gene neighbors in modules 24, 140, 141, 149
Gene neighbors (90)
Gene Common Name Description Module membership
MMP0034 GTP cyclohydrolase 130, 149
MMP0046 hypothetical protein MMP0046 20, 51, 140
MMP0074 hypothetical protein MMP0074 51, 140
MMP0076 deoxyribonuclease 24, 35
MMP0106 hypothetical protein MMP0106 107, 140
MMP0133 guaB inosine-5'-monophosphate dehydrogenase 25, 120, 140
MMP0134 hypothetical protein MMP0134 24, 92
MMP0137 dys putative deoxyhypusine synthase 25, 141, 149
MMP0210 hypothetical protein MMP0210 58, 140
MMP0220 Sodium/proline symporter-related 70, 140
MMP0224 hemL glutamate-1-semialdehyde aminotransferase 60, 130, 140
MMP0282 purE phosphoribosylaminoimidazole carboxylase catalytic subunit 7, 140
MMP0284 infB translation initiation factor IF-2 25, 149
MMP0319 cbiL precorrin-2 C-20 methyltransferase 24, 140, 141, 149
MMP0320 shikimate kinase 47, 141
MMP0340 pycB pyruvate carboxylase subunit B 24, 86, 120, 141, 149
MMP0346 2-hydroxyglutaryl-CoA dehydratase subunit D-like protein 7, 140
MMP0356 group 1 glycosyl transferase 80, 139, 140
MMP0415 O-sialoglycoprotein endopeptidase/protein kinase 47, 149
MMP0419 sodium:neurotransmitter symporter 24, 38
MMP0530 hypothetical protein MMP0530 92, 140
MMP0531 hypothetical protein MMP0531 106, 140
MMP0541 serB phosphoserine phosphatase SerB 7, 40, 139, 140
MMP0550 amino acid ABC transporter periplasmic protein 81, 140
MMP0554 SAM-binding motif-containing protein 129, 140
MMP0564 hypothetical protein MMP0564 111, 149
MMP0588 dph5 diphthine synthase 25, 81, 140
MMP0609 pth2 peptidyl-tRNA hydrolase 66, 140
MMP0637 ArsR family transcriptional regulator 24, 107
MMP0655 hypothetical protein MMP0655 24, 38, 52
MMP0679 Na+/H+ antiporter-like protein 24, 38
MMP0694 beta-lactamase-like protein 51, 109, 149
MMP0702 hypothetical protein MMP0702 24, 38, 162
MMP0705 wbpI UDP-N-acetylglucosamine 2-epimerase 80, 140
MMP0707 sodium/hydrogen exchanger 87, 109, 140
MMP0713 iorA2 indolepyruvate oxidoreductase subunit alpha 2 24, 47, 86
MMP0714 iorB2 indolepyruvate oxidoreductase subunit beta 24, 47, 86
MMP0715 coenzyme F390 synthetase II 24, 86
MMP0814 hypothetical protein MMP0814 24, 86
MMP0815 hypothetical protein MMP0815 24, 86
MMP0865 aminotransferase (subgroup II) adenosylmethionine-8-amino-7-oxononanoate aminotransferase 115, 140
MMP0878 ribonuclease P-like protein 25, 87, 140
MMP0880 aksF isopropylmalate/isohomocitrate dehydrogenase 24, 60, 140, 143
MMP0905 hypothetical protein MMP0905 14, 149
MMP0906 ribonuclease Z 129, 149
MMP0907 transcriptional regulator TrmB 14, 149
MMP0919 dihydroorotate dehydrogenase electron transfer subunit 86, 141
MMP0920 ahcY S-adenosyl-L-homocysteine hydrolase 80, 141
MMP0921 RNAse P, Rpr2/Rpp21 subunit 25, 141
MMP0941 hypothetical protein MMP0941 129, 149
MMP0953 cbiH precorrin-3B C17-methyltransferase 24, 25, 149
MMP0989 top6B DNA topoisomerase VI subunit B 139, 141
MMP0999 hypothetical protein MMP0999 95, 140
MMP1014 radical SAM domain-containing protein 25, 141
MMP1017 lysC aspartate kinase 24, 60, 112
MMP1068 K+-dependent Na+/Ca+ exchanger related-protein:Sodium/calcium exchanger membrane region 81, 140
MMP1085 hypothetical protein MMP1085 141, 143, 149
MMP1086 hypothetical protein MMP1086 122, 141
MMP1106 hypothetical protein MMP1106 81, 137, 140
MMP1107 Signal recognition particle protein SRP19 111, 141
MMP1108 corA magnesium/cobalt transporter CorA 141, 149
MMP1112 hypothetical protein MMP1112 111, 129, 141, 149
MMP1270 bifunctional hexulose-6-phosphate synthase/ribonuclease regulator 24, 38
MMP1307 methyltransferase-like protein 4, 149
MMP1312 hypothetical protein MMP1312 52, 140
MMP1313 fen-1 flap endonuclease-1 47, 52, 141
MMP1326 rpoN DNA-directed RNA polymerase subunit N 103, 118, 140
MMP1327 rpoK RNA polymerase Rpb6 103, 139, 149
MMP1328 enolase 103, 139, 149
MMP1353 hypothetical protein MMP1353 81, 140
MMP1356 PP-loop domain-containing protein 25, 129, 139, 140, 149
MMP1357 hypothetical protein MMP1357 140, 149
MMP1361 rpoB2 DNA-directed RNA polymerase subunit beta'' 25, 92, 109, 149
MMP1362 rpoB1 DNA-directed RNA polymerase subunit B' 63, 130, 140
MMP1363 rpoA1 DNA-directed RNA polymerase subunit A' 24, 103, 130
MMP1425 tRNA 2'-O-methylase 25, 87, 140
MMP1426 dcd bifunctional dCTP deaminase/dUTP diphosphatase 16, 112, 140
MMP1438 hypothetical protein MMP1438 14, 140
MMP1491 trzA amidohydrolase 14, 111, 122, 149
MMP1492 pyrE orotate phosphoribosyltransferase 14, 149
MMP1537 cytochrome c heme-binding site 24, 29
MMP1538 transporter component 24, 29
MMP1540 hypothetical protein MMP1540 24, 140
MMP1541 hypothetical protein MMP1541 24, 38
MMP1582 pdaD pyruvoyl-dependent arginine decarboxylase 87, 149
MMP1590 ExsB family protein 24, 51
MMP1614 hisS histidyl-tRNA synthetase 141, 149
MMP1659 pyrB aspartate carbamoyltransferase catalytic subunit 24, 111, 122
Unanno_2 None 24, 86
Unanno_4 None 24, 86
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for MMP0319
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend