Organism : Methanococcus maripaludis S2 | Module List :
MMP0989 top6B

DNA topoisomerase VI subunit B

CircVis
Functional Annotations (6)
Function System
DNA topoisomerase (ATP-hydrolyzing) activity go/ molecular_function
ATP binding go/ molecular_function
chromosome go/ cellular_component
DNA topological change go/ biological_process
DNA unwinding involved in replication go/ biological_process
top6b tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for MMP0989
(Mouseover regulator name to see its description)

MMP0989 is regulated by 14 influences and regulates 0 modules.
Regulators for MMP0989 top6B (14)
Regulator Module Operator
MMP0033 139 tf
MMP0033
H2
139 combiner
MMP0033
MMP0086
139 combiner
MMP0033
MMP0168
139 combiner
MMP0607 139 tf
MMP0631 139 tf
MMP0637 139 tf
MMP0907 139 tf
MMP1442
MMP1467
139 combiner
MMP1704 139 tf
MMP0033 141 tf
MMP0607 141 tf
MMP0907
MMP1646
141 combiner
MMP1704 141 tf

Warning: MMP0989 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
929 1.70e+01 T.aGGtgattT
Loader icon
930 4.20e+01 TgtgctTttTgaa.gcaa.caAc
Loader icon
933 7.10e+01 ATctctAtTcTttacATtcc
Loader icon
934 6.20e+03 GCAAATCATATTTGGTTTCATAC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for MMP0989

MMP0989 is enriched for 6 functions in 4 categories.
Enrichment Table (6)
Function System
DNA topoisomerase (ATP-hydrolyzing) activity go/ molecular_function
ATP binding go/ molecular_function
chromosome go/ cellular_component
DNA topological change go/ biological_process
DNA unwinding involved in replication go/ biological_process
top6b tigr/ tigrfam
Module neighborhood information for MMP0989

MMP0989 has total of 36 gene neighbors in modules 139, 141
Gene neighbors (36)
Gene Common Name Description Module membership
MMP0056 cofH FO synthase subunit 2 14, 139
MMP0137 dys putative deoxyhypusine synthase 25, 141, 149
MMP0152 citrate transporter 14, 139
MMP0319 cbiL precorrin-2 C-20 methyltransferase 24, 140, 141, 149
MMP0320 shikimate kinase 47, 141
MMP0340 pycB pyruvate carboxylase subunit B 24, 86, 120, 141, 149
MMP0353 UDP-glucose/GDP-mannose dehydrogenase-like protein 80, 139
MMP0356 group 1 glycosyl transferase 80, 139, 140
MMP0357 UDP-N-acetylglucosamine 2-epimerase 139, 157
MMP0358 hypothetical protein MMP0358 139, 157
MMP0541 serB phosphoserine phosphatase SerB 7, 40, 139, 140
MMP0579 hypothetical protein MMP0579 115, 139
MMP0919 dihydroorotate dehydrogenase electron transfer subunit 86, 141
MMP0920 ahcY S-adenosyl-L-homocysteine hydrolase 80, 141
MMP0921 RNAse P, Rpr2/Rpp21 subunit 25, 141
MMP0989 top6B DNA topoisomerase VI subunit B 139, 141
MMP1014 radical SAM domain-containing protein 25, 141
MMP1077 phosphoglucomutase/phosphomannomutase 40, 68, 139
MMP1085 hypothetical protein MMP1085 141, 143, 149
MMP1086 hypothetical protein MMP1086 122, 141
MMP1107 Signal recognition particle protein SRP19 111, 141
MMP1108 corA magnesium/cobalt transporter CorA 141, 149
MMP1112 hypothetical protein MMP1112 111, 129, 141, 149
MMP1117 hypothetical protein MMP1117 14, 47, 52, 139
MMP1189 ribose-5-phosphate isomerase A 60, 139
MMP1313 fen-1 flap endonuclease-1 47, 52, 141
MMP1327 rpoK RNA polymerase Rpb6 103, 139, 149
MMP1328 enolase 103, 139, 149
MMP1356 PP-loop domain-containing protein 25, 129, 139, 140, 149
MMP1499 hypothetical protein MMP1499 14, 139
MMP1500 ftsz2 cell division protein FtsZ 139, 157
MMP1554 hypothetical protein MMP1554 15, 139
MMP1610 hypothetical protein MMP1610 19, 139
MMP1614 hisS histidyl-tRNA synthetase 141, 149
MMP1648 hypothetical protein MMP1648 14, 47, 52, 139
MMP1711 pcnA proliferating cell nuclear antigen 115, 139
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for MMP0989
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend