Organism : Synechococcus elongatus PCC 7942 | Module List :
Synpcc7942_1178

photosystem II stability/assembly factor

CircVis
Functional Annotations (1)
Function System
Uncharacterized protein related to plant photosystem II stability/assembly factor cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for Synpcc7942_1178
(Mouseover regulator name to see its description)

Warning: No Regulators were found for Synpcc7942_1178!

Warning: Synpcc7942_1178 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 6 motifs predicted.

Motif Table (6)
Motif Id e-value Consensus Motif Logo
1649 3.90e+00 AGcCaATcgccgcAa
Loader icon
1650 1.50e+00 tgcTGAAaccGctg.AGAa
Loader icon
1651 3.30e+03 gttGCtgcAatgcctaAgcttttg
Loader icon
2006 1.20e+01 GGcgattgGcAaAat
Loader icon
2007 2.90e+02 acctGTCTcaTCaggGatcAgT
Loader icon
2008 3.80e+03 AATGCAGTGTCAAAGTAGGAAGAA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for Synpcc7942_1178

Synpcc7942_1178 is enriched for 1 functions in 3 categories.
Module neighborhood information for Synpcc7942_1178

Synpcc7942_1178 has total of 47 gene neighbors in modules 43, 163
Gene neighbors (47)
Gene Common Name Description Module membership
Synpcc7942_0075 aminopeptidase P (EC:3.4.11.9). Metallo peptidase. MEROPS family M24B (IMGterm) 160, 163
Synpcc7942_0076 "amino acid ABC transporter substrate-binding protein, PAAT family (TC 3.A.1.3.-) (IMGterm)" 12, 163
Synpcc7942_0165 hypothetical protein 11, 43
Synpcc7942_0166 asparaginase (EC 3.5.1.1) (IMGterm) 43, 122
Synpcc7942_0297 membrane protease FtsH catalytic subunit (EC 3.4.24.-) (IMGterm) 43, 84
Synpcc7942_0412 hypothetical protein 118, 163
Synpcc7942_0413 hypothetical protein 118, 163
Synpcc7942_0507 frr ribosome recycling factor (IMGterm) 148, 163
Synpcc7942_0694 SSU ribosomal protein S1P (IMGterm) 43, 200
Synpcc7942_0864 hypothetical protein 163, 186
Synpcc7942_0876 alaS alanyl-tRNA synthetase (EC 6.1.1.7) (IMGterm) 141, 163
Synpcc7942_0942 membrane protease FtsH catalytic subunit (EC 3.4.24.-) (IMGterm) 43, 84
Synpcc7942_1085 glycogen branching enzyme (EC 2.4.1.18) (IMGterm) 31, 43
Synpcc7942_1116 pgk phosphoglycerate kinase (EC 2.7.2.3) (IMGterm) 141, 163
Synpcc7942_1137 conserved hypothetical protein YCF23 115, 163
Synpcc7942_1174 photosystem II PsbJ protein 92, 163
Synpcc7942_1178 photosystem II stability/assembly factor 43, 163
Synpcc7942_1179 rubredoxin 43, 163
Synpcc7942_1180 NADH dehydrogenase subunit A (EC 1.6.5.3) (IMGterm) 43, 181
Synpcc7942_1181 NADH dehydrogenase subunit B (EC 1.6.5.3) (IMGterm) 43, 181
Synpcc7942_1182 NADH dehydrogenase subunit C (EC 1.6.5.3) (IMGterm) 43, 181
Synpcc7942_1184 6-pyruvoyl-tetrahydropterin synthase-like protein (EC:4.2.3.12) 43, 135
Synpcc7942_1497 hypothetical protein 43, 140
Synpcc7942_1521 Sec-independent protein translocase TatD (EC 3.1.21.-) (IMGterm) 43, 80
Synpcc7942_1522 rpoB DNA-directed RNA polymerase subunit beta (EC 2.7.7.6) (IMGterm) 19, 43
Synpcc7942_1523 DNA-directed RNA polymerase gamma chain (EC 2.7.7.6) (IMGterm) 19, 43
Synpcc7942_1524 DNA-directed RNA polymerase subunit beta' (EC 2.7.7.6) (IMGterm) 5, 43
Synpcc7942_1552 ketol-acid reductoisomerase (EC 1.1.1.86) (IMGterm) 141, 163
Synpcc7942_1555 hypothetical protein 141, 163
Synpcc7942_1591 RNA binding S1 141, 163
Synpcc7942_1594 acyl-ACP reductase (IMGterm) 141, 163
Synpcc7942_1618 Single-stranded nucleic acid binding R3H 138, 163
Synpcc7942_1654 hypothetical protein 43, 127
Synpcc7942_1736 Iron-regulated ABC transporter ATPase subunit SufC (IMGterm) 5, 43
Synpcc7942_1737 Iron-regulated ABC transporter permease protein SufD (IMGterm) 5, 43
Synpcc7942_1738 cysteine desulfurase (EC 2.8.1.7) (IMGterm) 5, 43
Synpcc7942_1739 "transcriptional regulator, MerR family (IMGterm)" 43, 124
Synpcc7942_1846 hypothetical protein (EC:3.1.-) 43, 186
Synpcc7942_1847 dihydrodipicolinate synthase (EC 4.2.1.52) (IMGterm) 34, 43
Synpcc7942_1848 aspartate semialdehyde dehydrogenase (EC 1.2.1.11) (IMGterm) 43, 80
Synpcc7942_1908 hypothetical protein 160, 163
Synpcc7942_2299 rpsO SSU ribosomal protein S15P (IMGterm) 43, 110
Synpcc7942_2300 hypothetical protein 81, 163
Synpcc7942_2302 hypothetical protein 43, 90
Synpcc7942_2345 conserved hypothetical protein YCF65 43, 112
Synpcc7942_2455 hypothetical protein 163, 186
Synpcc7942_2487 hypothetical protein 43, 84
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for Synpcc7942_1178
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend