Organism : Clostridium acetobutylicum | Module List :
CAC2254

Response regulator (CheY-like receiver domain and HTH-type DNA-binding domain) (NCBI ptt file)

CircVis
Functional Annotations (8)
Function System
Response regulator containing a CheY-like receiver domain and an HTH DNA-binding domain cog/ cog
two-component response regulator activity go/ molecular_function
two-component signal transduction system (phosphorelay) go/ biological_process
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
protein-glutamate methylesterase activity go/ molecular_function
sequence-specific DNA binding go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for CAC2254
(Mouseover regulator name to see its description)

CAC2254 is regulated by 25 influences and regulates 16 modules.
Regulators for CAC2254 (25)
Regulator Module Operator
CAC0766 100 tf
CAC0859 100 tf
CAC1463 100 tf
CAC1578 100 tf
CAC1689 100 tf
CAC1696 100 tf
CAC2254 100 tf
CAC2430 100 tf
CAC2950 100 tf
CAC3143 100 tf
CAC3466 100 tf
CAC3611 100 tf
CAC0078 285 tf
CAC0191 285 tf
CAC1467 285 tf
CAC1578 285 tf
CAC1695 285 tf
CAC2060 285 tf
CAC2209 285 tf
CAC2254 285 tf
CAC2306 285 tf
CAC2307 285 tf
CAC2773 285 tf
CAC3271 285 tf
CAC3409 285 tf

Warning: CAC2254 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
6852 3.40e-01 AGGaGGTG
Loader icon
6853 7.10e+03 GGAGGC
Loader icon
7222 1.80e+00 aAgggtGcaaaaGt
Loader icon
7223 2.10e+03 GCTTATCCTTTTACTTAAAGCC
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for CAC2254

CAC2254 is enriched for 8 functions in 3 categories.
Module neighborhood information for CAC2254

CAC2254 has total of 43 gene neighbors in modules 100, 285
Gene neighbors (43)
Gene Common Name Description Module membership
CAC0117 121 protein cheY homolog (NCBI ptt file) 107, 285
CAC0121 cheR Chemotaxis protein methyltransferase (cheR) (NCBI ptt file) 100, 324
CAC0152 CAC0152 Ribosomal-protein-alanine acetyltransferase (acetylating enzyme for N-terminal of ribosomal protein S5) (NCBI ptt file) 265, 285
CAC0311 CAC0311 PolyA polymerase (NCBI ptt file) 285, 355
CAC0355 CAC0355 Putative polygalacturonase (pectinase) (NCBI ptt file) 100, 258
CAC0384 licB PTS system, cellobiose-specific component BII (NCBI ptt file) 285, 324
CAC0385 CAC0385 Beta-glucosidase (NCBI ptt file) 285, 324
CAC0386 licC PTS cellobiose-specific component IIC (NCBI ptt file) 82, 285
CAC0387 CAC0387 Hypothetical protein (NCBI ptt file) 285, 324
CAC0456 lonA ATP-dependent protease (lonA) (NCBI ptt file) 100, 336
CAC0542 CAC0542 Methyl-accepting chemotaxis protein (NCBI ptt file) 70, 285
CAC0741 CAC0741 Methyl-accepting chemotaxis protein (NCBI ptt file) 24, 285
CAC0994 CAC0994 Predicted membrane protein (NCBI ptt file) 100, 345
CAC1233 chev Chemotaxis protein CheV ortholog (CheW-like adaptor domain and CheY-like reciever domain) (NCBI ptt file) 93, 285
CAC1387 CAC1387 Membrane associated chemotaxis sensory transducer protein (MSP domain and HAMP domain) (NCBI ptt file) 100, 208
CAC1403 CAC1403 Zn-dependent hydrolase, glyoxylase II family (NCBI ptt file) 100, 315
CAC1433 CAC1433 Hypothetical protein (NCBI ptt file) 285, 319
CAC1483 CAC1483 Predicted transcriptional regulator (NCBI ptt file) 100, 317
CAC1572 CAC1572 Fructose-1,6-bisphosphatase (YYDE B.subtils ortholog) (NCBI ptt file) 100, 114
CAC1701 CAC1701 Sensory histidine kinase (with HAMP and PAS domains) (NCBI ptt file) 100, 329
CAC2154 flgE Flagellar hook protein FlgE. (NCBI ptt file) 96, 285
CAC2194 CAC2194 Predicted nucleoside-diphosphate sugar epimerase (NCBI ptt file) 96, 285
CAC2243 asnB N-terminal domain of asparagine synthase (NCBI ptt file) 100, 114
CAC2254 CAC2254 Response regulator (CheY-like receiver domain and HTH-type DNA-binding domain) (NCBI ptt file) 100, 285
CAC2338 CAC2338 Lysine decarboxylase (NCBI ptt file) 82, 285
CAC2343 CAC2343 LPS biosynthesis O-acetyl transferase (NCBI ptt file) 100, 345
CAC2345 CAC2345 Glycosyltransferase (NCBI ptt file) 100, 279
CAC2346 CAC2346 Glycosyltransferase (NCBI ptt file) 3, 100
CAC2349 CAC2349 Hypothetical protein (NCBI ptt file) 13, 100
CAC2350 CAC2350 Sugar transaminase, involved in dTDP-4-amino-4,6-dideoxyglucose biosynthesis (NCBI ptt file) 100, 137
CAC2351 CAC2351 Glycosyltransferase (NCBI ptt file) 100, 256
CAC2437 CAC2437 Uncharacterized conserved protein (NCBI ptt file) 100, 109
CAC2488 CAC2488 Uncharacterized conserved protein, YTFE family (NCBI ptt file) 285, 367
CAC2844 galT Galactose-1-phosphate uridylyltransferase (NCBI ptt file) 5, 100
CAC2846 secA Preprotein translocase subunit SecA (ATPase, RNA helicase) (NCBI ptt file) 100, 329
CAC3003 thyA Thymidylate synthase (NCBI ptt file) 100, 258
CAC3271 CAC3271 Transcriptional regulator, AcrR family (NCBI ptt file) 223, 285
CAC3272 CAC3272 Possible surface protein, responsible for cell interaction; contains cell adhesion domain and ChW-repeats (NCBI ptt file) 285, 359
CAC3299 bdhA NADH-dependent butanol dehydrogenase A (BDH I) (NCBI ptt file) 91, 100
CAC3333 CAC3333 Uncharacterized conserved protein, related to pyruvate formate-lyase activating enzyme (NCBI ptt file) 265, 285
CAC3586 cinA Competence-damage inducible protein, CINA (NCBI ptt file) 79, 100
CAC3660 CAC3660 Uncharacterized protein, homolog of Desulfovibrio gigas (gi:6978031) (NCBI ptt file) 100, 317
CAC3734 thdF Predicted GTPase, ThdF family (NCBI ptt file) 5, 100
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for CAC2254
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend