Organism : Geobacter sulfurreducens | Module List :
GSU2666

transcriptional regulator, TetR family (VIMSS)

CircVis
Functional Annotations (5)
Function System
Transcriptional regulator cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
regulation of transcription, DNA-dependent go/ biological_process
specific transcriptional repressor activity go/ molecular_function
negative regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for GSU2666
(Mouseover regulator name to see its description)

GSU2666 is regulated by 20 influences and regulates 18 modules.
Regulators for GSU2666 (20)
Regulator Module Operator
GSU1522 244 tf
GSU1692 244 tf
GSU1727 244 tf
GSU1863 244 tf
GSU2237 244 tf
GSU2581 244 tf
GSU2666 244 tf
GSU2817 244 tf
GSU3053 244 tf
GSU3087 244 tf
GSU3387 244 tf
GSU0732 53 tf
GSU1218 53 tf
GSU1320 53 tf
GSU1525 53 tf
GSU1692 53 tf
GSU1989 53 tf
GSU1992 53 tf
GSU2945 53 tf
GSU3089 53 tf

Warning: GSU2666 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
2266 6.10e+02 taaaGTTctTacagg
Loader icon
2267 2.40e+03 aAAATCAaaCaAcTgC.AA
Loader icon
2648 4.30e+01 cAaccT.aaGacacttcTCCTgg
Loader icon
2649 6.80e+02 AAAATTCACCCACAACCTTCAAGA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for GSU2666

GSU2666 is enriched for 5 functions in 3 categories.
Module neighborhood information for GSU2666

GSU2666 has total of 42 gene neighbors in modules 53, 244
Gene neighbors (42)
Gene Common Name Description Module membership
GSU0051 GSU0051 CRISPR-associated HD domain protein (NCBI) 188, 244
GSU0070 GSU0070 oxidoreductase, membrane subunit (VIMSS) 211, 244
GSU0144 GSU0144 sensory box histidine kinase (VIMSS) 53, 85
GSU0304 pepN aminopeptidase N (NCBI) 53, 290
GSU0421 fliM flagellar motor switch protein FliM (NCBI) 234, 244
GSU0500 typA GTP-binding protein TypA (NCBI) 53, 320
GSU0657 GSU0657 hypothetical protein (VIMSS) 53, 315
GSU0681 GSU0681 sensory box histidine kinase (VIMSS) 53, 85
GSU0708 GSU0708 multidrug resistance protein (VIMSS) 234, 244
GSU0827 GSU0827 hypothetical protein (VIMSS) 27, 53
GSU0829 GSU0829 heavy metal efflux pump, CzcB family (VIMSS) 27, 53
GSU0897 GSU0897 conserved hypothetical protein (VIMSS) 234, 244
GSU0904 GSU0904 HD domain protein (VIMSS) 234, 244
GSU1036 GSU1036 sensor histidine kinase (VIMSS) 53, 157
GSU1414 GSU1414 sensory box histidine kinase/response regulator (VIMSS) 53, 275
GSU1427 GSU1427 anti-anti-sigma factor (VIMSS) 53, 268
GSU1430 GSU1430 hypothetical protein (VIMSS) 53, 229
GSU1551 GSU1551 bacterial signal domain protein (VIMSS) 104, 244
GSU1642 GSU1642 conserved hypothetical protein (VIMSS) 27, 53
GSU1673 GSU1673 hypothetical protein (VIMSS) 53, 200
GSU1817 GSU1817 outer membrane lipoprotein, Slp family, putative (VIMSS) 53, 264
GSU1857 GSU1857 hypothetical protein (VIMSS) 53, 203
GSU1989 GSU1989 sigma-54 dependent DNA-binding response regulator (VIMSS) 53, 268
GSU1990 GSU1990 sensor histidine kinase (VIMSS) 53, 200
GSU2327 GSU2327 conserved hypothetical protein (VIMSS) 175, 244
GSU2329 cfa cyclopropane-fatty-acyl-phospholipid synthase (NCBI) 175, 244
GSU2664 GSU2664 outer membrane efflux protein (VIMSS) 181, 244
GSU2665 GSU2665 efflux transporter, RND family, MFP subunit (NCBI) 53, 244
GSU2666 GSU2666 transcriptional regulator, TetR family (VIMSS) 53, 244
GSU2667 GSU2667 sensory box histidine kinase (VIMSS) 145, 244
GSU2668 GSU2668 hypothetical protein (VIMSS) 53, 244
GSU2669 GSU2669 sensor histidine kinase (VIMSS) 53, 244
GSU2678 hsp heat shock protein, Hsp20 family (NCBI) 53, 200
GSU2692 GSU2692 immunogenic protein family protein (VIMSS) 53, 194
GSU2723 GSU2723 molybdopterin binding domain protein (NCBI) 145, 244
GSU2755 GSU2755 periplasmic substrate-binding protein/sensor histidine kinase (VIMSS) 234, 244
GSU3017 GSU3017 conserved domain protein (VIMSS) 178, 244
GSU3086 GSU3086 conserved hypothetical protein (VIMSS) 53, 258
GSU3088 GSU3088 ybaK/ebsC protein (VIMSS) 53, 324
GSU3089 rpoD RNA polymerase sigma factor RpoD (NCBI) 53, 267
GSU3095 hisF imidazoleglycerol phosphate synthase, cyclase subunit (NCBI) 53, 99
GSU3139 GSU3139 conserved hypothetical protein (VIMSS) 53, 216
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for GSU2666
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend