Organism : Methanococcus maripaludis S2 | Module List :
MMP1469 ehbA

putative monovalent cation/H+ antiporter subunit E

CircVis
Functional Annotations (5)
Function System
Multisubunit Na+/H+ antiporter, MnhE subunit cog/ cog
cation transport go/ biological_process
cation transmembrane transporter activity go/ molecular_function
integral to membrane go/ cellular_component
Methane metabolism kegg/ kegg pathway
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for MMP1469
(Mouseover regulator name to see its description)

MMP1469 is regulated by 5 influences and regulates 0 modules.
Regulators for MMP1469 ehbA (5)
Regulator Module Operator
MMP0041
MMP1023
106 combiner
MMP0460
MMP0799
106 combiner
MMP0568
H2
106 combiner
MMP0799
MMP1065
106 combiner
MMP1065 106 tf

Warning: MMP1469 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
681 4.20e-03 cTAtTTATCATgATtgATAATtA
Loader icon
682 1.20e+03 CTAACGGTGc
Loader icon
869 1.10e+03 CGAGTAAACCGGATAGCTTAC
Loader icon
870 5.60e+03 TGaagGGCaGtggcA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for MMP1469

MMP1469 is enriched for 5 functions in 3 categories.
Enrichment Table (5)
Function System
Multisubunit Na+/H+ antiporter, MnhE subunit cog/ cog
cation transport go/ biological_process
cation transmembrane transporter activity go/ molecular_function
integral to membrane go/ cellular_component
Methane metabolism kegg/ kegg pathway
Module neighborhood information for MMP1469

MMP1469 has total of 61 gene neighbors in modules 10, 106
Gene neighbors (61)
Gene Common Name Description Module membership
MMP0001 hypothetical protein MMP0001 46, 106, 121, 144
MMP0002 L-seryl-tRNA selenium transferase 12, 46, 76, 106, 121
MMP0030 MCM family DNA replication protein 106, 117
MMP0084 hypothetical protein MMP0084 49, 106
MMP0085 hypothetical protein MMP0085 22, 106
MMP0091 hypothetical protein MMP0091 51, 106
MMP0239 hypothetical protein MMP0239 1, 49, 75, 106
MMP0420 CBS domain-containing protein 13, 106
MMP0425 hypothetical protein MMP0425 57, 102, 106
MMP0426 nitroreductase family protein 57, 102, 106, 153
MMP0531 hypothetical protein MMP0531 106, 140
MMP0535 hypothetical protein MMP0535 57, 102, 106
MMP0598 phosphoglycerate mutase-related 106, 151
MMP0605 putative RNA-processing protein 12, 106
MMP0630 feoB ferrous iron transporter 28, 76, 106, 121
MMP0808 hypothetical protein MMP0808 12, 106
MMP0809 phosphoribosylaminoimidazole carboxylase-like protein 12, 106
MMP0958 hypothetical protein MMP0958 57, 102, 106
MMP0959 trxB FAD-dependent pyridine nucleotide-disulfide oxidoreductase 57, 102, 106
MMP0969 hypothetical protein MMP0969 106, 115
MMP0984 cdh acetyl-CoA decarbonylase/synthase complex subunit epsilon 10, 17
MMP0985 cdhA acetyl-CoA decarbonylase/synthase complex subunit alpha 10, 17
MMP1001 hypothetical protein MMP1001 57, 102, 106
MMP1051 surE stationary phase survival protein SurE 12, 28, 106
MMP1069 basic helix-loop-helix dimerization domain-containing protein 106, 115
MMP1071 hypothetical protein MMP1071 1, 106
MMP1072 aminotransferase (subgroup I) aromatic aminotransferase 1, 106
MMP1073 ehbC putative monovalent cation/H+ antiporter subunit G 35, 106
MMP1074 ehbD hypothetical protein MMP1074 17, 106
MMP1091 ADP-glucose pyrophosphorylase 99, 106
MMP1152 hypothetical protein MMP1152 10, 147
MMP1153 ehbN energy conserving hydrogenase B large subunit 10, 147
MMP1234 UBA/THIF-type NAD/FAD binding protein 33, 54, 55, 106
MMP1235 moaE molybdopterin biosynthesis MoaE 49, 55, 106, 117, 150
MMP1271 vorA 2-oxoisovalerate oxidoreductase subunit alpha 10, 17
MMP1272 vorB 2-ketoisovalerate ferredoxin reductase 10, 147
MMP1273 vorC 2-oxoisovalerate oxidoreductase subunit gamma 10, 147
MMP1274 AMP-dependent synthetase and ligase 10, 17
MMP1275 hypothetical protein MMP1275 10, 147
MMP1282 hypothetical protein MMP1282 49, 102, 106, 150
MMP1469 ehbA putative monovalent cation/H+ antiporter subunit E 10, 106
MMP1502 porF hypothetical protein MMP1502 10, 17
MMP1503 porE pyruvate oxidoreductase-associated 10, 17
MMP1504 porB pyruvate ferredoxin oxidoreductase subunit beta 10, 17
MMP1505 porA pyruvate oxidoreductase (synthase) subunit alpha 10, 17
MMP1506 porD pyruvate oxidoreductase (synthase) subunit delta 10, 17
MMP1507 porC pyruvate ferredoxin oxidoreductase subunit gamma 10, 17
MMP1573 bioD dethiobiotin synthase 28, 106
MMP1598 hypothetical protein MMP1598 76, 102, 106
MMP1611 hypothetical protein MMP1611 21, 106
MMP1621 ehbO energy conserving hydrogenase B integral membrane subunit 10, 147
MMP1622 ehbM energy conserving hydrogenase B small subunit 10, 147
MMP1623 ehbL ferredoxin 10, 147
MMP1624 ehbK polyferredoxin 10, 147
MMP1625 ehbJ hypothetical protein MMP1625 10, 147
MMP1626 putative monovalent cation/H+ antiporter subunit B 10, 147
MMP1627 ehbG hypothetical protein MMP1627 10, 147
MMP1628 ehbF hydrogenase subunit F 10, 147
MMP1629 ehbE putative monovalent cation/H+ antiporter subunit C 10, 147
MMP1682 recJ single stranded DNA-specific exonuclease 21, 106
MMP1712 LysR family transcriptional regulator 19, 106
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for MMP1469
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend