Organism : Bacillus subtilis | Module List :
BSU16800 spoIIIE

spore DNA translocase (RefSeq)

CircVis
Functional Annotations (8)
Function System
DNA segregation ATPase FtsK/SpoIIIE and related proteins cog/ cog
DNA binding go/ molecular_function
ATP binding go/ molecular_function
cell cycle go/ biological_process
chromosome segregation go/ biological_process
integral to membrane go/ cellular_component
nucleoside-triphosphatase activity go/ molecular_function
cell division go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU16800
(Mouseover regulator name to see its description)

BSU16800 is regulated by 15 influences and regulates 0 modules.
Regulators for BSU16800 spoIIIE (15)
Regulator Module Operator
BSU00700 116 tf
BSU02500 116 tf
BSU05390 116 tf
BSU15640 116 tf
BSU16810 116 tf
BSU35520 116 tf
BSU36630 116 tf
BSU05050 23 tf
BSU16810 23 tf
BSU18460 23 tf
BSU24520 23 tf
BSU33740 23 tf
BSU33970 23 tf
BSU35840 23 tf
BSU36630 23 tf

Warning: BSU16800 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5008 1.80e+01 tTcatCaCctt
Loader icon
5009 3.00e+02 GCTGGCTGAtgCAG
Loader icon
5186 1.00e+05 ATCTCTTTAGATGTTAGGTTT
Loader icon
5187 6.40e+00 TC.TtTtTTTa
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU16800

BSU16800 is enriched for 8 functions in 3 categories.
Enrichment Table (8)
Function System
DNA segregation ATPase FtsK/SpoIIIE and related proteins cog/ cog
DNA binding go/ molecular_function
ATP binding go/ molecular_function
cell cycle go/ biological_process
chromosome segregation go/ biological_process
integral to membrane go/ cellular_component
nucleoside-triphosphatase activity go/ molecular_function
cell division go/ biological_process
Module neighborhood information for BSU16800

BSU16800 has total of 48 gene neighbors in modules 23, 116
Gene neighbors (48)
Gene Common Name Description Module membership
BSU05070 yddQ putative hydrolase (RefSeq) 23, 255
BSU05250 ydeM putative dehydratase (RefSeq) 23, 102
BSU05390 ydfF putative transcriptional regulator (RefSeq) 94, 116
BSU08650 fabL enoyl-(acyl carrier protein) reductase (RefSeq) 116, 253
BSU09620 yhdW putative glycerophosphodiester phosphodiesterase (RefSeq) 23, 258
BSU11020 yitK putative nucleotide-binding protein (RefSeq) 23, 163
BSU11580 yjbK putative RNA/thiamine triphosphatase (RefSeq) 116, 167
BSU11590 yjbL putative phosphatase (RefSeq) 116, 194
BSU11600 yjbM (p)ppGpp synthetase (RefSeq) 116, 194
BSU11980 yjdA 3-ketoacyl-(acyl-carrier-protein) reductase (RefSeq) 23, 276
BSU13280 ykoJ hypothetical protein (RefSeq) 116, 146
BSU13750 ykvM 7-cyano-7-deazaguanine reductase (RefSeq) 23, 409
BSU13820 ykvT cell wall hydrolase related to spore cortex-lytic enzymes (RefSeq) 116, 216
BSU14550 ykrA putative hydrolase (RefSeq) 23, 255
BSU16000 ylqC putative RNA binding protein (RefSeq) 116, 212
BSU16800 spoIIIE spore DNA translocase (RefSeq) 23, 116
BSU16810 ymfC putative transcriptional regulator (GntR family) (RefSeq) 23, 116
BSU17050 mutL DNA mismatch repair protein (RefSeq) 116, 228
BSU18460 gltC transcriptional regulator (LysR family) (RefSeq) 23, 402
BSU18640 yoaK hypothetical protein (RefSeq) 23, 327
BSU18990 yobK hypothetical protein (RefSeq) 113, 116
BSU19000 yobL putative phage DNA manipulating enzyme (RefSeq) 113, 116
BSU19340 yocR putative sodium-dependent transporter (RefSeq) 116, 191
BSU21720 ypmT hypothetical protein (RefSeq) 116, 170
BSU22910 ypfA putative cyclic diGMP binding protein (RefSeq) 7, 116
BSU23760 coaA pantothenate kinase (RefSeq) 116, 233
BSU24930 yqzD hypothetical protein (RefSeq) 23, 197
BSU24940 yqzC hypothetical protein (RefSeq) 23, 197
BSU25110 yqfU putative integral inner membrane protein (RefSeq) 116, 123
BSU31110 yubF hypothetical protein (RefSeq) 23, 197
BSU31150 yubB undecaprenyl pyrophosphate phosphatase (RefSeq) 116, 155
BSU31800 yueF putative integral inner membrane protein (RefSeq) 23, 237
BSU32330 lipA lipoyl synthase (RefSeq) 116, 128
BSU32620 yurQ putative excinuclease (RefSeq) 116, 309
BSU33110 liaG conserved hypothetical protein (response to antibiotic stress) (RefSeq) 23, 191
BSU33860 yvbH hypothetical protein (RefSeq) 23, 167
BSU33970 araR transcriptional repressor of the ara regulon (LacI family) (RefSeq) 23, 255
BSU34640 yvdD hypothetical protein (RefSeq) 23, 247
BSU34650 yvdC putative pyrophosphohydrolase (RefSeq) 23, 247
BSU34810 yvcD hypothetical protein (RefSeq) 14, 23
BSU35260 ftsE cell-division ABC transporter (ATP-binding protein) (RefSeq) 13, 116
BSU36560 ywnH putative phosphinothricin acetyltransferase (RefSeq) 23, 197
BSU36570 ywnG putative integral inner membrane protein (RefSeq) 23, 197
BSU36630 ywnA hypothetical protein (RefSeq) 13, 23
BSU38220 ywcC putative transcriptional regulator (RefSeq) 102, 116
BSU38360 ywbD putative AdoMet-dependent methyltransferase (RefSeq) 116, 157
BSU39550 yxeH putative hydrolase (RefSeq) 116, 233
BSU40650 yybG hypothetical protein (RefSeq) 36, 116
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU16800
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend