Organism : Bacillus subtilis | Module List :
BSU26390 spoIIIC

RNA polymerase sporulation-specific sigma factor (sigma-K) (C-terminal half) (RefSeq)

CircVis
Functional Annotations (5)
Function System
sequence-specific DNA binding transcription factor activity go/ molecular_function
transcription initiation, DNA-dependent go/ biological_process
regulation of transcription, DNA-dependent go/ biological_process
sigma factor activity go/ molecular_function
RNA polymerase kegg/ kegg pathway
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU26390
(Mouseover regulator name to see its description)

BSU26390 is regulated by 15 influences and regulates 13 modules.
Regulators for BSU26390 spoIIIC (15)
Regulator Module Operator
BSU03620 356 tf
BSU26390 356 tf
BSU27000 356 tf
BSU27520 356 tf
BSU33580 356 tf
BSU35080 356 tf
BSU36020 356 tf
BSU36160 356 tf
BSU37650 356 tf
BSU03880 263 tf
BSU05460 263 tf
BSU18760 263 tf
BSU26390 263 tf
BSU27120 263 tf
BSU35650 263 tf
Regulated by BSU26390 (13)
Module Residual Genes
21 0.33 19
45 0.33 18
99 0.35 20
126 0.32 20
165 0.43 7
217 0.51 21
224 0.31 19
263 0.48 13
278 0.48 26
280 0.39 21
339 0.47 30
343 0.44 22
356 0.54 11
Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
5466 1.60e+01 CTGGCAGGCGCCGTCGGTCATG
Loader icon
5467 3.40e+03 taaAAGGAggt
Loader icon
5636 9.60e+02 aTacagatGaaAAgg
Loader icon
5637 6.10e+03 GGTGTATGGGATG
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU26390

BSU26390 is enriched for 5 functions in 4 categories.
Enrichment Table (5)
Function System
sequence-specific DNA binding transcription factor activity go/ molecular_function
transcription initiation, DNA-dependent go/ biological_process
regulation of transcription, DNA-dependent go/ biological_process
sigma factor activity go/ molecular_function
RNA polymerase kegg/ kegg pathway
Module neighborhood information for BSU26390

BSU26390 has total of 23 gene neighbors in modules 263, 356
Gene neighbors (23)
Gene Common Name Description Module membership
BSU03260 ycgS putative aromatic hydrocarbon hydrolase (RefSeq) 356, 378
BSU03390 yckC putative integral inner membrane protein (RefSeq) 263, 316
BSU04120 yczI hypothetical protein (RefSeq) 145, 263
BSU04520 ydbM putative acyl-CoA dehydrogenase (RefSeq) 80, 356
BSU09710 yheI ABC transporter (ATP-binding protein) involved in the signalling pathway that activates KinA during sporulation initiation (RefSeq) 73, 356
BSU09730 yheG putative NADH-flavin oxidoreductase (RefSeq) 108, 263
BSU10740 yisJ putative spore coat protein (RefSeq) 55, 356
BSU12090 cotT spore coat protein (inner coat) (RefSeq) 174, 263
BSU13170 guaD guanine deaminase (RefSeq) 137, 356
BSU14620 slp small peptidoglycan-associated lipoprotein (RefSeq) 356, 379
BSU14800 ylaJ putative lipoprotein (RefSeq) 239, 263
BSU16870 fabG 3-ketoacyl-(acyl-carrier-protein) reductase (RefSeq) 229, 356
BSU20490 yoqW conserved hypothetical protein; putative general secretion pathway protein; phage SPbeta (RefSeq) 337, 356
BSU25730 yqeC 6-phosphogluconate dehydrogenase-like protein (RefSeq) 231, 263
BSU25740 yqeB hypothetical protein (RefSeq) 263, 316
BSU26390 spoIIIC RNA polymerase sporulation-specific sigma factor (sigma-K) (C-terminal half) (RefSeq) 263, 356
BSU26450 yrkN putative N-acetyltransferase (RefSeq) 31, 263
BSU28830 ysdB hypothetical protein (RefSeq) 263, 379
BSU33640 yvaM putative hydrolase (RefSeq) 55, 356
BSU35080 yvmB putative transcriptional regulator (RefSeq) 121, 356
BSU38030 ywdA hypothetical protein (RefSeq) 31, 263
BSU38940 yxjI hypothetical protein (RefSeq) 166, 263
BSU39830 yxcA hypothetical protein (RefSeq) 263, 291
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU26390
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend