Organism : Bacillus subtilis | Module List :
BSU40910 rpsF

30S ribosomal protein S6 (RefSeq)

CircVis
Functional Annotations (6)
Function System
Ribosomal protein S6 cog/ cog
structural constituent of ribosome go/ molecular_function
ribosome go/ cellular_component
translation go/ biological_process
Ribosome kegg/ kegg pathway
S6 tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for BSU40910
(Mouseover regulator name to see its description)

BSU40910 is regulated by 23 influences and regulates 0 modules.
Regulators for BSU40910 rpsF (23)
Regulator Module Operator
BSU01010 119 tf
BSU01430 119 tf
BSU04650 119 tf
BSU05050 119 tf
BSU07590 119 tf
BSU09510 119 tf
BSU15470 119 tf
BSU15640 119 tf
BSU16170 119 tf
BSU16470 119 tf
BSU24320 119 tf
BSU35840 119 tf
BSU37160 119 tf
BSU01010 3 tf
BSU01430 3 tf
BSU04650 3 tf
BSU05050 3 tf
BSU07590 3 tf
BSU09510 3 tf
BSU15470 3 tf
BSU16170 3 tf
BSU24320 3 tf
BSU37160 3 tf

Warning: BSU40910 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.

Motif Table (4)
Motif Id e-value Consensus Motif Logo
4968 4.80e+02 AGtccaaaAgGagaTGcAtAcA
Loader icon
4969 1.20e+03 TATccgCtGCAAgaatG
Loader icon
5190 5.90e+02 CAAGGTCATAGAGCCGTTTTCGAC
Loader icon
5191 1.10e+03 AGGAGgtg
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for BSU40910

BSU40910 is enriched for 6 functions in 3 categories.
Enrichment Table (6)
Function System
Ribosomal protein S6 cog/ cog
structural constituent of ribosome go/ molecular_function
ribosome go/ cellular_component
translation go/ biological_process
Ribosome kegg/ kegg pathway
S6 tigr/ tigrfam
Module neighborhood information for BSU40910

BSU40910 has total of 28 gene neighbors in modules 3, 119
Gene neighbors (28)
Gene Common Name Description Module membership
BSU01090 ybxF putative ribosomal protein L7Ae-like (RefSeq) 3, 104
BSU01100 rpsL 30S ribosomal protein S12 (RefSeq) 3, 119
BSU01490 rplM 50S ribosomal protein L13 (RefSeq) 103, 119
BSU01500 rpsI 30S ribosomal protein S9 (RefSeq) 3, 103
BSU12280 rex transcriptional repressor of the rex ndh operon (RefSeq) 119, 266
BSU12290 ndh NADH dehydrogenase (RefSeq) 119, 266
BSU12840 pit low-affinity inorganic phosphate transporter (RefSeq) 119, 385
BSU12850 ykaA putative Pit accessory protein (RefSeq) 3, 119
BSU13900 ptsH phosphocarrier protein HPr (RefSeq) 119, 355
BSU13910 ptsI phosphotransferase system (PTS) enzyme I (RefSeq) 119, 355
BSU15070 ylbN hypothetical protein (RefSeq) 3, 374
BSU15080 rpmF 50S ribosomal protein L32 (RefSeq) 3, 103
BSU15820 rpmB 50S ribosomal protein L28 (RefSeq) 119, 197
BSU16040 rplS 50S ribosomal protein L19 (RefSeq) 3, 119
BSU16680 rpsO 30S ribosomal protein S15 (RefSeq) 119, 197
BSU24530 yqhM putative lipoate protein ligase (RefSeq) 119, 197
BSU24540 yqhL putative sulfur transferase (RefSeq) 119, 197
BSU27610 apt adenine phosphoribosyltransferase (RefSeq) 119, 204
BSU27940 rpmA 50S ribosomal protein L27 (RefSeq) 3, 103
BSU27950 ysxB hypothetical protein (RefSeq) 3, 103
BSU27960 rplU 50S ribosomal protein L21 (RefSeq) 3, 103
BSU29660 rpsD 30S ribosomal protein S4 (RefSeq) 119, 197
BSU31390 yugI general stress protein 13 (RefSeq) 3, 119
BSU37070 rpmE 50S ribosomal protein L31 (RefSeq) 3, 119
BSU40890 rpsR 30S ribosomal protein S18 (RefSeq) 3, 103
BSU40900 ssbA single-strand DNA-binding protein (RefSeq) 3, 103
BSU40910 rpsF 30S ribosomal protein S6 (RefSeq) 3, 119
BSU41060 rpmH 50S ribosomal protein L34 (RefSeq) 119, 266
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for BSU40910
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend