Organism : Desulfovibrio vulgaris Hildenborough | Module List :
DVU1283 galU

UTP-glucose-1-phosphate uridylyltransferase

CircVis
Functional Annotations (11)
Function System
UDP-glucose pyrophosphorylase cog/ cog
UTP:glucose-1-phosphate uridylyltransferase activity go/ molecular_function
UDP-glucose metabolic process go/ biological_process
biosynthetic process go/ biological_process
Pentose and glucuronate interconversions kegg/ kegg pathway
Galactose metabolism kegg/ kegg pathway
Starch and sucrose metabolism kegg/ kegg pathway
Amino sugar and nucleotide sugar metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Biosynthesis of secondary metabolites kegg/ kegg pathway
galU tigr/ tigrfam
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for DVU1283
(Mouseover regulator name to see its description)

DVU1283 is regulated by 18 influences and regulates 0 modules.
Regulators for DVU1283 galU (18)
Regulator Module Operator
DVU0110
DVU1419
60 combiner
DVU1144 60 tf
DVU1949 60 tf
DVU2547
DVU2251
60 combiner
DVU2557
DVU1419
60 combiner
DVU2557
DVU2547
60 combiner
DVU2788
DVU2394
60 combiner
DVU2788
DVU2557
60 combiner
DVU2909
DVU1949
60 combiner
DVU3084
DVU1419
60 combiner
DVU0118
DVU2251
249 combiner
DVU0230 249 tf
DVU0230
DVU2989
249 combiner
DVU0653
DVU2251
249 combiner
DVU0854
DVU2251
249 combiner
DVU2686
DVU0118
249 combiner
DVU2989 249 tf
DVU3220
DVU2251
249 combiner

Warning: DVU1283 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.
Click on the RegPredict links to explore the motif in RegPredict.

Motif Table (4)
Motif Id e-value Consensus Motif Logo RegPredict
117 2.80e+02 ACATAGAGAGAGGTTACAAAAGAT
Loader icon
RegPredict
118 2.50e+02 aTgtacggGaAaAtcCacA
Loader icon
RegPredict
475 3.20e+01 cttcgc..t.tgtctTG.Cgc
Loader icon
RegPredict
476 1.00e+04 TtgtTaTttTc.AgAaGTtT
Loader icon
RegPredict
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for DVU1283

DVU1283 is enriched for 11 functions in 3 categories.
Enrichment Table (11)
Function System
UDP-glucose pyrophosphorylase cog/ cog
UTP:glucose-1-phosphate uridylyltransferase activity go/ molecular_function
UDP-glucose metabolic process go/ biological_process
biosynthetic process go/ biological_process
Pentose and glucuronate interconversions kegg/ kegg pathway
Galactose metabolism kegg/ kegg pathway
Starch and sucrose metabolism kegg/ kegg pathway
Amino sugar and nucleotide sugar metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Biosynthesis of secondary metabolites kegg/ kegg pathway
galU tigr/ tigrfam
Module neighborhood information for DVU1283

DVU1283 has total of 55 gene neighbors in modules 60, 249
Gene neighbors (55)
Gene Common Name Description Module membership
DVU0019 ngr nigerythrin 60, 348
DVU0121 hypothetical protein DVU0121 206, 249
DVU0276 hypothetical protein DVU0276 60, 71
DVU0423 universal stress protein 60, 109
DVU0490 None 60, 136
DVU0521 csrA carbon storage regulator 184, 249
DVU0565 gap-1 glyceraldehyde 3-phosphate dehydrogenase 60, 71
DVU0566 GAF domain-containing protein 60, 71
DVU0773 hypothetical protein DVU0773 60, 157
DVU0881 fusA elongation factor G 60, 115
DVU0882 hypothetical protein DVU0882 53, 60
DVU0883 glutaredoxin 60, 148
DVU0974 hypothetical protein DVU0974 60, 132
DVU0979 dihydroxyacetone kinase subunit DhaK 60, 348
DVU0995 ThiJ/PfpI family protein 60, 153
DVU1051 ccmE cytochrome c-type biogenesis protein CcmE 14, 249
DVU1283 galU UTP-glucose-1-phosphate uridylyltransferase 60, 249
DVU1372 hypothetical protein DVU1372 232, 249
DVU1373 divIVA cell-division initiation protein DivIVA 232, 249
DVU1374 hypothetical protein DVU1374 232, 249
DVU1375 hypothetical protein DVU1375 232, 249
DVU1377 ilvH acetolactate synthase 3 regulatory subunit 232, 249
DVU1378 ilvC ketol-acid reductoisomerase 232, 249
DVU1397 bfr bacterioferritin 60, 274
DVU1422 OmpA family protein 60, 115
DVU1528 cytidine/deoxycytidylate deaminase family protein 60, 71
DVU1529 decarboxylase 60, 71
DVU1541 hypothetical protein DVU1541 60, 115
DVU1881 phoH family protein 12, 249
DVU1882 HDIG domain-containing protein 95, 249
DVU1883 hypothetical protein DVU1883 117, 249
DVU1887 hypothetical protein DVU1887 128, 249
DVU1910 YjeF-like protein 146, 249
DVU2212 hypothetical protein DVU2212 60, 132
DVU2328 hydrogenase nickel insertion protein HypA 145, 249
DVU2349 carbohydrate phosphorylase family protein 60, 192
DVU2427 hypothetical protein DVU2427 60, 71
DVU2430 RNA-binding protein 249, 296
DVU2508 murF UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 249, 301
DVU2509 murE UDP-N-acetylmuramoylalanyl-D-glutamate-2,6-diaminopimelate ligase 249, 301
DVU2514 pyk pyruvate kinase 249, 348
DVU2612 hypothetical protein DVU2612 63, 249
DVU3042 lipoprotein 60, 274
DVU3045 sensory box histidine kinase/response regulator 11, 249
DVU3097 outer membrane efflux protein 141, 249
DVU3112 hypothetical protein 249, 315
DVU3113 carA carbamoyl phosphate synthase small subunit 14, 249
DVU3183 rbO desulfoferrodoxin 60, 348
DVU3184 rubredoxin 60, 348
DVU3185 roO rubredoxin-oxygen oxidoreductase 60, 348
DVU3197 ilvE branched-chain amino acid aminotransferase 220, 249
DVU3293 acetolactate synthase 60, 348
DVU3335 sensory box histidine kinase 162, 249
DVU3355 SPFH domain-containing protein/band 7 family protein 60, 268
DVU3392 glnA glutamine synthetase, type I 60, 135
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for DVU1283
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend