Organism : Desulfovibrio vulgaris Hildenborough | Module List :
DVU3185 roO

rubredoxin-oxygen oxidoreductase

CircVis
Functional Annotations (4)
Function System
Uncharacterized flavoproteins cog/ cog
FMN binding go/ molecular_function
oxidoreductase activity go/ molecular_function
hydrolase activity go/ molecular_function
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for DVU3185
(Mouseover regulator name to see its description)

DVU3185 is regulated by 21 influences and regulates 0 modules.
Regulators for DVU3185 roO (21)
Regulator Module Operator
DVU0230
DVU1949
348 combiner
DVU0277
DVU0118
348 combiner
DVU0277
DVU2894
348 combiner
DVU0653
DVU2251
348 combiner
DVU0946
DVU2251
348 combiner
DVU1788 348 tf
DVU2547
DVU0110
348 combiner
DVU2547
DVU2251
348 combiner
DVU2547
DVU3193
348 combiner
DVU2909 348 tf
DVU3220
DVU2251
348 combiner
DVU0110
DVU1419
60 combiner
DVU1144 60 tf
DVU1949 60 tf
DVU2547
DVU2251
60 combiner
DVU2557
DVU1419
60 combiner
DVU2557
DVU2547
60 combiner
DVU2788
DVU2394
60 combiner
DVU2788
DVU2557
60 combiner
DVU2909
DVU1949
60 combiner
DVU3084
DVU1419
60 combiner

Warning: DVU3185 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 4 motifs predicted.
Click on the RegPredict links to explore the motif in RegPredict.

Motif Table (4)
Motif Id e-value Consensus Motif Logo RegPredict
117 2.80e+02 ACATAGAGAGAGGTTACAAAAGAT
Loader icon
RegPredict
118 2.50e+02 aTgtacggGaAaAtcCacA
Loader icon
RegPredict
661 6.00e+02 CtTTccaGCcgtcCcGACgtCgGa
Loader icon
RegPredict
662 1.60e+03 ctgaC.tcCaTaacggtctggtac
Loader icon
RegPredict
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for DVU3185

DVU3185 is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Uncharacterized flavoproteins cog/ cog
FMN binding go/ molecular_function
oxidoreductase activity go/ molecular_function
hydrolase activity go/ molecular_function
Module neighborhood information for DVU3185

DVU3185 has total of 59 gene neighbors in modules 60, 348
Gene neighbors (59)
Gene Common Name Description Module membership
DVU0019 ngr nigerythrin 60, 348
DVU0092 sensory box histidine kinase 145, 348
DVU0175 tungsten formylmethanofuran dehydrogenase family protein/molybdopterin binding protein 192, 348
DVU0260 response regulator 346, 348
DVU0263 acidic cytochrome c3 346, 348
DVU0264 ferredoxin, 4Fe-4S 346, 348
DVU0276 hypothetical protein DVU0276 60, 71
DVU0402 dsvA dissimilatory sulfite reductase subunit alpha 292, 348
DVU0403 dvsB dissimilatory sulfite reductase subunit beta 292, 348
DVU0404 dissimilatory sulfite reductase B 292, 348
DVU0423 universal stress protein 60, 109
DVU0490 None 60, 136
DVU0565 gap-1 glyceraldehyde 3-phosphate dehydrogenase 60, 71
DVU0566 GAF domain-containing protein 60, 71
DVU0701 glcB malate synthase G 192, 348
DVU0773 hypothetical protein DVU0773 60, 157
DVU0881 fusA elongation factor G 60, 115
DVU0882 hypothetical protein DVU0882 53, 60
DVU0883 glutaredoxin 60, 148
DVU0974 hypothetical protein DVU0974 60, 132
DVU0979 dihydroxyacetone kinase subunit DhaK 60, 348
DVU0980 DAK2 domain-containing protein 6, 348
DVU0995 ThiJ/PfpI family protein 60, 153
DVU1179 aor tungsten-containing aldehyde:ferredoxin oxidoreductase 157, 348
DVU1283 galU UTP-glucose-1-phosphate uridylyltransferase 60, 249
DVU1397 bfr bacterioferritin 60, 274
DVU1422 OmpA family protein 60, 115
DVU1528 cytidine/deoxycytidylate deaminase family protein 60, 71
DVU1529 decarboxylase 60, 71
DVU1541 hypothetical protein DVU1541 60, 115
DVU1681 mreB-2 rod shape-determining protein MreB 318, 348
DVU1684 gcvT glycine cleavage system T protein 318, 348
DVU1685 16S ribosomal RNA methyltransferase RsmE 318, 348
DVU1686 recombination factor protein RarA 318, 348
DVU1917 hysB periplasmic 139, 348
DVU1918 hysA periplasmic 139, 348
DVU1921 hynB-1 periplasmic 229, 348
DVU1922 hynA-1 periplasmic 229, 348
DVU2109 hypothetical protein DVU2109 236, 348
DVU2212 hypothetical protein DVU2212 60, 132
DVU2349 carbohydrate phosphorylase family protein 60, 192
DVU2427 hypothetical protein DVU2427 60, 71
DVU2481 formate dehydrogenase subunit beta 77, 348
DVU2482 fdnG-2 formate dehydrogenase subunit alpha, selenocysteine-containing 192, 348
DVU2483 cytochrome c family protein 77, 348
DVU2514 pyk pyruvate kinase 249, 348
DVU2557 birA birA bifunctional protein 148, 348
DVU3037 rhodanese-like domain-containing protein 192, 348
DVU3042 lipoprotein 60, 274
DVU3183 rbO desulfoferrodoxin 60, 348
DVU3184 rubredoxin 60, 348
DVU3185 roO rubredoxin-oxygen oxidoreductase 60, 348
DVU3262 fdrA fumarate reductase flavoprotein subunit 153, 348
DVU3263 frdB fumarate reductase iron-sulfur subunit 148, 348
DVU3293 acetolactate synthase 60, 348
DVU3294 aldehyde dehydrogenase family protein 153, 348
DVU3319 putA proline dehydrogenase/delta-1-pyrroline-5-carboxylate dehydrogenase 153, 348
DVU3355 SPFH domain-containing protein/band 7 family protein 60, 268
DVU3392 glnA glutamine synthetase, type I 60, 135
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for DVU3185
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend