Organism : Halobacterium salinarum NRC-1 | Module List :
VNG1785G panF

hypothetical protein VNG1785G

CircVis
Functional Annotations (4)
Function System
Na+/proline symporter cog/ cog
transporter activity go/ molecular_function
transport go/ biological_process
membrane go/ cellular_component
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG1785G
(Mouseover regulator name to see its description)

VNG1785G is regulated by 31 influences and regulates 0 modules.
Regulators for VNG1785G panF (31)
Regulator Module Operator
VNG0835G
VNG6288C
57 combiner
VNG5176C
VNG6288C
57 combiner
VNG6143H 57 tf
VNG6389G 57 tf
VNG0826C
VNG5176C
86 combiner
VNG0835G
VNG6288C
86 combiner
VNG1548C 86 tf
VNG5176C
VNG6288C
86 combiner
VNG6193H 86 tf
VNG6389G 86 tf
VNG0147C
VNG6288C
232 combiner
VNG1510C 232 tf
VNG1510C
VNG6288C
232 combiner
VNG1548C 232 tf
VNG1786H 232 tf
VNG5176C
VNG6288C
232 combiner
VNG6389G 232 tf
VNG0147C
VNG1405C
298 combiner
VNG0835G 298 tf
VNG0835G
VNG1405C
298 combiner
VNG0835G
VNG6288C
298 combiner
VNG1405C 298 tf
VNG5176C
VNG6288C
298 combiner
VNG6193H 298 tf
VNG6389G 298 tf
VNG0147C
VNG6288C
243 combiner
VNG1510C
VNG6288C
243 combiner
VNG1548C 243 tf
VNG5142G 243 tf
VNG5176C
VNG6288C
243 combiner
VNG6389G 243 tf

Warning: VNG1785G Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 10 motifs predicted.

Motif Table (10)
Motif Id e-value Consensus Motif Logo
1089 8.20e+01 Ggatc.cgaacgtcGttttCG
Loader icon
1090 1.00e+04 AaATCAaCAacACAGATAcacTA
Loader icon
1147 3.00e-06 .taatctatgcagAaActaTttat
Loader icon
1148 5.90e+01 AAAAGAGTTACGAATTTCGTA
Loader icon
1401 1.60e+03 tcCatccactAaCAa
Loader icon
1402 8.00e+03 ATTTGTA
Loader icon
1421 4.20e+00 TggATAaAgAA
Loader icon
1422 2.90e+03 cTcg.taaCaGtaacT.ctA
Loader icon
1517 1.40e-04 AAataTt.ttTTcG.tgCttagaT
Loader icon
1518 6.00e+02 CAgT..tgcACGAcaTCGACcA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG1785G

VNG1785G is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Na+/proline symporter cog/ cog
transporter activity go/ molecular_function
transport go/ biological_process
membrane go/ cellular_component
Module neighborhood information for VNG1785G

VNG1785G has total of 50 gene neighbors in modules 57, 86, 232, 243, 298
Gene neighbors (50)
Gene Common Name Description Module membership
VNG0027H hypothetical protein VNG0027H 26, 31, 72, 232, 243
VNG0117H hypothetical protein VNG0117H 72, 207, 209, 243, 298
VNG0138H hypothetical protein VNG0138H 57, 209, 298
VNG0243Cm truD tRNA pseudouridine synthase D 86, 130, 209, 298
VNG0298H hypothetical protein VNG0298H 57, 269, 298
VNG0301C nicotinamide-nucleotide adenylyltransferase 57, 298
VNG0318G dpg dolichol-P-glucose synthetase 118, 160, 232, 243
VNG0396C hypothetical protein VNG0396C 26, 57, 243
VNG0407H hypothetical protein VNG0407H 139, 298
VNG0462C hypothetical protein VNG0462C 42, 57, 68, 151, 162, 246
VNG0498C hypothetical protein VNG0498C 139, 298
VNG0499G cna proliferating-cell nucleolar antigen 57, 86, 139, 209, 298
VNG0595H hypothetical protein VNG0595H 139, 209, 298
VNG0612H hypothetical protein VNG0612H 26, 243
VNG0622H hypothetical protein VNG0622H 139, 209, 298
VNG0763G ybjG membrane protein 57, 243
VNG0818C hypothetical protein VNG0818C 86, 106, 243, 298
VNG0875Cm Zn-dependent protease 139, 298
VNG0938G gufA GufA protein 57, 86, 139, 209, 298
VNG1000H hypothetical protein VNG1000H 20, 26, 31, 232
VNG1174G nop56/58 nucleolar protein-like protein 57, 284
VNG1394H hypothetical protein VNG1394H 86, 209, 214, 298
VNG1429C 2-phospho-L-lactate transferase 31, 232, 243
VNG1455H hypothetical protein VNG1455H 26, 31, 57, 86
VNG1470G pri DNA primase small subunit 139, 298
VNG1574G cobI cobalamin adenosyltransferase 86, 210
VNG1681C hypothetical protein VNG1681C 20, 26, 28, 31, 147, 232
VNG1785G panF hypothetical protein VNG1785G 57, 86, 232, 243, 298
VNG1815G carA carbamoyl phosphate synthase small subunit 68, 86, 209, 257, 294, 298
VNG1816G trh3 transcription regulator 68, 86, 139, 209, 238, 257, 298
VNG1818G idi Idi 68, 86, 209, 214, 234, 257
VNG1917H hypothetical protein VNG1917H 139, 209, 298
VNG2002H hypothetical protein VNG2002H 26, 232
VNG2087G hisH imidazole glycerol phosphate synthase subunit HisH 86, 106, 209, 298
VNG2156C hypothetical protein VNG2156C 57, 106, 209, 243, 298
VNG2270G mutS3 hypothetical protein VNG2270G 57, 86, 298
VNG2335H hypothetical protein VNG2335H 57, 86, 106, 139, 209, 257, 298
VNG6143H hypothetical protein VNG6143H 5, 26, 31, 72, 86, 106, 204, 232, 243, 295, 298
VNG6145H hypothetical protein VNG6145H 31, 72, 86, 106, 232, 298
VNG6339H hypothetical protein VNG6339H 26, 31, 69, 86, 106, 204, 232
VNG6348H hypothetical protein VNG6348H 85, 86, 106, 160, 209
VNG6365H hypothetical protein VNG6365H 86, 209
VNG6384H hypothetical protein VNG6384H 20, 131, 160, 232
VNG6432H hypothetical protein VNG6432H 17, 26, 31, 38, 106, 243
VNG6439H hypothetical protein VNG6439H 26, 31, 243
VNG7047 hypothetical protein VNG7047 57, 86, 209, 216, 298
VNG7056 hypothetical protein VNG7056 86, 105, 106, 186, 209, 232, 238, 243, 257, 298
VNG7099 hypothetical protein VNG7099 57, 209
VNG7117 hypothetical protein VNG7117 86, 106
VNG7127 hypothetical protein VNG7127 86, 106, 209, 257, 298
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG1785G
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend