Organism : Halobacterium salinarum NRC-1 | Module List :
VNG6170H

hypothetical protein VNG6170H

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG6170H
(Mouseover regulator name to see its description)

VNG6170H is regulated by 50 influences and regulates 0 modules.
Regulators for VNG6170H (50)
Regulator Module Operator
VNG1237C 5 tf
VNG1548C 5 tf
VNG2112C 5 tf
VNG1237C 4 tf
VNG2112C 4 tf
VNG6143H 4 tf
VNG1510C 26 tf
VNG1548C 26 tf
VNG6389G 26 tf
VNG1179C 85 tf
VNG1548C 85 tf
VNG1617H
VNG0389C
85 combiner
VNG2112C 85 tf
VNG5163G 85 tf
VNG6143H 85 tf
VNG1237C 36 tf
VNG2112C 36 tf
VNG5163G 36 tf
VNG6143H 36 tf
VNG2112C 28 tf
VNG6143H 28 tf
VNG1179C 122 tf
VNG1237C 122 tf
VNG2112C 122 tf
VNG6143H 122 tf
VNG0835G
VNG1451C
72 combiner
VNG1786H 72 tf
VNG6389G 72 tf
VNG1179C 15 tf
VNG1237C 15 tf
VNG6143H 15 tf
VNG1179C 60 tf
VNG1237C 60 tf
VNG6143H 60 tf
VNG1179C 69 tf
VNG1548C 69 tf
VNG6143H 69 tf
VNG6389G 69 tf
VNG0835G
VNG1451C
63 combiner
VNG1237C 63 tf
VNG1390H 63 tf
VNG2112C 63 tf
VNG6143H 63 tf
VNG1237C 53 tf
VNG2112C 53 tf
VNG6143H 53 tf
VNG1548C 31 tf
VNG2112C 31 tf
VNG6389G 31 tf
VNG6438G
VNG6288C
31 combiner

Warning: VNG6170H Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 28 motifs predicted.

Motif Table (28)
Motif Id e-value Consensus Motif Logo
987 3.00e-03 aAaAc.Acg.cCtagctaaaatAa
Loader icon
988 8.90e-01 GtCTTggGCGAaTaGAAAtCTTCt
Loader icon
989 1.10e+02 aAAtatAaaa.agga.taat
Loader icon
990 8.30e+02 cgtccgCGA.tcG.t
Loader icon
1009 1.40e-04 AAATatAAAtaAgat
Loader icon
1010 2.50e-03 AaGtctAtTttgAGtgAAtGggA
Loader icon
1029 2.30e-02 gtTtcAgcaccGgcTctGaATagA
Loader icon
1030 6.00e-03 atACtcttACaaagATAAAgaaGg
Loader icon
1033 9.50e+01 CGA.Cacgtcg.tgacgctcA
Loader icon
1034 1.30e+03 t.A.tgaatTAcGGa
Loader icon
1039 2.20e-03 gAcAtc.A..AacaA
Loader icon
1040 7.70e+02 aATATAAa
Loader icon
1049 2.40e+03 TT.aaATcCGGt
Loader icon
1050 3.50e+03 tCCtggCTtGGCTaccCaCGCtC
Loader icon
1081 1.00e-01 gtcctCGaCGcgctcCTcGc.Gt
Loader icon
1082 2.50e-01 CGtc.gCgAC.gCGa
Loader icon
1095 1.40e+00 Cagcgacc.ggcgtTcctc.ctgt
Loader icon
1096 2.70e+02 AACGAATCGTGTCACGCACCTCAA
Loader icon
1101 1.40e+03 ATacTCCGACAAaT
Loader icon
1102 2.00e+03 GCaGTAGtG
Loader icon
1113 4.20e-01 aaatta.tTAtcatt
Loader icon
1114 2.30e+03 ATCGtT
Loader icon
1119 6.30e+01 CAT..tccgAcaaatacg.A
Loader icon
1120 6.70e+01 TCGaTgtgtTCgT
Loader icon
1145 1.70e+01 taat..acAAa.gtatgcgtagt.
Loader icon
1146 8.80e+01 AtCgtcaGTaaTg
Loader icon
1217 8.90e+02 tgAaat.T
Loader icon
1218 2.30e+03 tGACaA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG6170H

Warning: No Functional annotations were found!

Module neighborhood information for VNG6170H

VNG6170H has total of 118 gene neighbors in modules 4, 5, 15, 26, 28, 31, 36, 53, 60, 63, 69, 72, 85, 122
Gene neighbors (118)
Gene Common Name Description Module membership
VNG0018H hypothetical protein VNG0018H 122, 239
VNG0027H hypothetical protein VNG0027H 26, 31, 72, 232, 243
VNG0034H hypothetical protein VNG0034H 28, 83
VNG0057H hypothetical protein VNG0057H 26, 254
VNG0076H hypothetical protein VNG0076H 28, 254
VNG0117H hypothetical protein VNG0117H 72, 207, 209, 243, 298
VNG0140H hypothetical protein VNG0140H 18, 26, 30, 239
VNG0157G oxlT oxalate/formate antiporter 53, 265
VNG0216H hypothetical protein VNG0216H 4, 13, 15, 20, 32, 43, 92, 93, 94, 103, 104, 105
VNG0217H hypothetical protein VNG0217H 13, 15, 20, 32, 43, 53, 92, 93, 94, 103, 105
VNG0218G gspE1 type II secretion system protein 107, 122
VNG0396C hypothetical protein VNG0396C 26, 57, 243
VNG0573C hypothetical protein VNG0573C 4, 5, 26, 28
VNG0596H hypothetical protein VNG0596H 53
VNG0612H hypothetical protein VNG0612H 26, 243
VNG0731H hypothetical protein VNG0731H 43, 53, 164
VNG0825C hypothetical protein VNG0825C 4, 5, 32, 43
VNG0883H hypothetical protein VNG0883H 5, 26
VNG0985H hypothetical protein VNG0985H 4, 5, 164
VNG1000H hypothetical protein VNG1000H 20, 26, 31, 232
VNG1041H hypothetical protein VNG1041H 28
VNG1050H hypothetical protein VNG1050H 28, 53, 60
VNG1299C hypothetical protein VNG1299C 53, 285
VNG1388H hypothetical protein VNG1388H 36, 250
VNG1390H hypothetical protein VNG1390H 36, 173, 250
VNG1395G htr9 Htr9 13, 60, 281
VNG1429C 2-phospho-L-lactate transferase 31, 232, 243
VNG1453H hypothetical protein VNG1453H 4, 28
VNG1455H hypothetical protein VNG1455H 26, 31, 57, 86
VNG1457C hypothetical protein VNG1457C 5
VNG1492C hypothetical protein VNG1492C 36
VNG1520G mutY A/G specific adenine glycosylase, repair protein 4, 5, 53
VNG1548C hypothetical protein VNG1548C 28, 293
VNG1577C hypothetical protein VNG1577C 20, 53, 96, 140, 173
VNG1580H hypothetical protein VNG1580H 20, 53, 140, 173, 277
VNG1582G hisC2 hypothetical protein VNG1582G 20, 53, 96, 140, 173
VNG1589C hypothetical protein VNG1589C 4, 5, 8, 28, 69, 85, 204
VNG1622G rfcB replication factor C large subunit 5, 28, 53, 140
VNG1648G trpF hypothetical protein VNG1648G 4, 5, 28, 30, 48, 64, 87
VNG1649G trpD anthranilate phosphoribosyltransferase 28, 30, 48, 64, 87, 92
VNG1650H hypothetical protein VNG1650H 4, 5, 30, 34, 35, 245, 295
VNG1681C hypothetical protein VNG1681C 20, 26, 28, 31, 147, 232
VNG1781C hypothetical protein VNG1781C 21, 53, 60
VNG1783H hypothetical protein VNG1783H 53
VNG1784C DNA primase 28, 42, 68, 83, 234
VNG1902H hypothetical protein VNG1902H 53
VNG1918C geranylgeranylglyceryl phosphate synthase-like protein 13, 20, 53, 60
VNG1952H hypothetical protein VNG1952H 18, 28, 30, 42, 68, 80, 91, 108, 121, 135
VNG1959G tgtA1 7-cyano-7-deazaguanine tRNA-ribosyltransferase 53, 129, 130, 132, 133
VNG1964H hypothetical protein VNG1964H 28, 63
VNG1976H hypothetical protein VNG1976H 26, 31, 60
VNG1986C hypothetical protein VNG1986C 17, 26, 30, 31, 108
VNG2002H hypothetical protein VNG2002H 26, 232
VNG2032Gm FAD1 enoyl-CoA hydratase 85
VNG2096G cctB thermosome subunit beta 4, 5, 28, 53, 140, 173
VNG2100G iluA threonine dehydratase 5, 20, 26, 28
VNG2108G thrC3 threonine synthase 28
VNG2112C hypothetical protein VNG2112C 60, 166, 167, 169
VNG2214G dinF DNA damage-inducible protein 53, 60, 173
VNG2242C hypothetical protein VNG2242C 53
VNG2386C hypothetical protein VNG2386C 13, 28
VNG2444C hypothetical protein VNG2444C 17, 28, 31, 38, 173
VNG2466C None 13, 31, 64, 70, 166
VNG2488C hypothetical protein VNG2488C 122
VNG2490H hypothetical protein VNG2490H 36, 122
VNG2586C F420-0--gamma-glutamyl ligase 53, 206
VNG2678H hypothetical protein VNG2678H 28
VNG5047H None 15, 18, 63
VNG6143H hypothetical protein VNG6143H 5, 26, 31, 72, 86, 106, 204, 232, 243, 295, 298
VNG6144G trsE transfer complex protein 4, 5, 42, 68, 295
VNG6145H hypothetical protein VNG6145H 31, 72, 86, 106, 232, 298
VNG6150G orc1 orc / cell division control protein 6 4, 13, 38, 142, 189
VNG6152H hypothetical protein VNG6152H 4, 13, 15, 26, 31, 37, 142, 189, 272, 281, 297
VNG6165H hypothetical protein VNG6165H 85
VNG6170H hypothetical protein VNG6170H 4, 5, 15, 26, 28, 31, 36, 53, 60, 63, 69, 72, 85, 122
VNG6171H hypothetical protein VNG6171H 85
VNG6173C hypothetical protein VNG6173C 85
VNG6175G trkA2 TRK potassium uptake system protein 5, 15, 62, 69, 72, 177
VNG6176G kdpA potassium-transporting ATPase subunit A 5, 15, 18, 21, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6177G kdpB potassium-transporting ATPase subunit B 5, 15, 62, 63, 69, 72
VNG6178G kdpC potassium-transporting ATPase C chain 5, 15, 18, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6179G cat3 cationic amino acid transporter 62, 72
VNG6183C hypothetical protein VNG6183C 15, 18, 213
VNG6184G cat4 cationic amino acid transporter 15, 18, 213
VNG6185H hypothetical protein VNG6185H 15, 18, 213
VNG6186H hypothetical protein VNG6186H 15, 18, 213
VNG6196G phoT2 sodium-dependent phosphate transporter 30, 36, 41, 80, 87, 89
VNG6198H hypothetical protein VNG6198H 31
VNG6230G gvpK2 GvpK protein, cluster B 4, 5, 8, 22, 28, 31, 141, 148, 181, 182, 188, 200
VNG6232G gvpJ2 GvpJ protein, cluster B 4, 5, 8, 28, 31, 42, 141, 148, 182, 188
VNG6233G gvpI2 GvpI protein, cluster B 31, 141, 188
VNG6235G gvpH2 GvpH protein, cluster B 31, 42, 141, 188
VNG6236G gvpG2 GvpG protein, cluster B 8, 28, 141, 148, 181, 182, 188
VNG6239G gvpE2 GvpE protein, cluster B 4, 5, 8, 28, 141, 148, 182, 188, 200
VNG6244G gvpN2 GvpN protein, cluster B 5, 26, 53, 185
VNG6266H hypothetical protein VNG6266H 31, 146
VNG6306C hypothetical protein VNG6306C 28
VNG6339H hypothetical protein VNG6339H 26, 31, 69, 86, 106, 204, 232
VNG6343H hypothetical protein VNG6343H 47, 69, 85
VNG6348H hypothetical protein VNG6348H 85, 86, 106, 160, 209
VNG6364H hypothetical protein VNG6364H 31, 106
VNG6375H hypothetical protein VNG6375H 13, 60, 121, 189
VNG6377H hypothetical protein VNG6377H 13, 60, 121, 189
VNG6378H hypothetical protein VNG6378H 13, 21, 53, 60, 121, 189, 281
VNG6390H hypothetical protein VNG6390H 4, 26, 30, 34, 35, 245, 295
VNG6404H hypothetical protein VNG6404H 28, 69
VNG6406H hypothetical protein VNG6406H 5, 127
VNG6409H hypothetical protein VNG6409H 85, 152, 153, 158, 160, 198, 203
VNG6416H hypothetical protein VNG6416H 13, 15, 21, 41, 60, 281
VNG6418H hypothetical protein VNG6418H 13, 18, 21, 41, 60, 281
VNG6419H hypothetical protein VNG6419H 13, 21, 60, 281
VNG6424H hypothetical protein VNG6424H 13, 15, 189
VNG6431H hypothetical protein VNG6431H 17, 26, 30, 38, 178
VNG6432H hypothetical protein VNG6432H 17, 26, 31, 38, 106, 243
VNG6439H hypothetical protein VNG6439H 26, 31, 243
VNG7011 repH plasmid replication protein RepH 17, 18, 30, 107, 122, 224, 287
VNG7109 hypothetical protein VNG7109 4, 18, 38, 91
VNG7128 hypothetical protein VNG7128 21, 60, 281
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG6170H
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend