Organism : Halobacterium salinarum NRC-1 | Module List :
VNG6418H

hypothetical protein VNG6418H

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG6418H
(Mouseover regulator name to see its description)

VNG6418H is regulated by 30 influences and regulates 0 modules.
Regulators for VNG6418H (30)
Regulator Module Operator
VNG1237C 13 tf
VNG2112C 13 tf
VNG6143H 13 tf
VNG6287H 13 tf
VNG6438G 13 tf
VNG1179C 41 tf
VNG1237C 41 tf
VNG2112C 41 tf
VNG6143H 41 tf
VNG6389G 41 tf
VNG6438G 41 tf
VNG1179C 60 tf
VNG1237C 60 tf
VNG6143H 60 tf
VNG1179C 18 tf
VNG1786H 18 tf
VNG2112C 18 tf
VNG6143H 18 tf
VNG1179C 281 tf
VNG1237C 281 tf
VNG1886C 281 tf
VNG2112C 281 tf
VNG6143H 281 tf
VNG6438G 281 tf
VNG1179C 21 tf
VNG1237C 21 tf
VNG1548C 21 tf
VNG2112C 21 tf
VNG6143H 21 tf
VNG6438G 21 tf

Warning: VNG6418H Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 12 motifs predicted.

Motif Table (12)
Motif Id e-value Consensus Motif Logo
1005 1.20e+01 CGaccgagagGAacgcgtGGA
Loader icon
1006 8.20e+00 GTtTGAgGTGcgtGAcACGATTC
Loader icon
1015 0.00e+00 AccAttcaC.caaActacacata
Loader icon
1016 0.00e+00 Aactgatt.AaAtctaAaaaagta
Loader icon
1021 1.40e+02 Tt.t.actgTtTgtc
Loader icon
1022 8.40e+02 cGTaCt.GACG
Loader icon
1059 3.50e+01 AatttcTctTgcGGAagta
Loader icon
1060 1.20e+04 CcacGAcgAaCgCC
Loader icon
1095 1.40e+00 Cagcgacc.ggcgtTcctc.ctgt
Loader icon
1096 2.70e+02 AACGAATCGTGTCACGCACCTCAA
Loader icon
1491 2.00e+00 aAAatGtgTaTG
Loader icon
1492 4.30e+03 ATcaTCTGAAT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG6418H

Warning: No Functional annotations were found!

Module neighborhood information for VNG6418H

VNG6418H has total of 72 gene neighbors in modules 13, 18, 21, 41, 60, 281
Gene neighbors (72)
Gene Common Name Description Module membership
VNG0055H hypothetical protein VNG0055H 37, 41, 183, 185
VNG0139H hypothetical protein VNG0139H 17, 18, 30, 196
VNG0140H hypothetical protein VNG0140H 18, 26, 30, 239
VNG0148H hypothetical protein VNG0148H 41, 80, 171, 189, 196, 219, 224
VNG0196H hypothetical protein VNG0196H 30, 267, 281
VNG0204H hypothetical protein VNG0204H 41
VNG0216H hypothetical protein VNG0216H 4, 13, 15, 20, 32, 43, 92, 93, 94, 103, 104, 105
VNG0217H hypothetical protein VNG0217H 13, 15, 20, 32, 43, 53, 92, 93, 94, 103, 105
VNG0512G ppe DNA double-strand break repair protein 18, 121, 177, 196
VNG0869G tfbD transcription initiation factor IIB 18, 91, 95, 212
VNG1050H hypothetical protein VNG1050H 28, 53, 60
VNG1066C hypothetical protein VNG1066C 13, 96, 102, 108
VNG1270H hypothetical protein VNG1270H 18, 30, 37, 42
VNG1271H hypothetical protein VNG1271H 18, 30, 37
VNG1395G htr9 Htr9 13, 60, 281
VNG1525C hypothetical protein VNG1525C 41
VNG1534a birA biotin operon repressor and biotin-(acetyl-CoA carboxylase) ligase 41
VNG1590H hypothetical protein VNG1590H 13, 281
VNG1781C hypothetical protein VNG1781C 21, 53, 60
VNG1890H hypothetical protein VNG1890H 18, 105, 167
VNG1918C geranylgeranylglyceryl phosphate synthase-like protein 13, 20, 53, 60
VNG1952H hypothetical protein VNG1952H 18, 28, 30, 42, 68, 80, 91, 108, 121, 135
VNG1953C hypothetical protein VNG1953C 13, 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1956H hypothetical protein VNG1956H 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1976H hypothetical protein VNG1976H 26, 31, 60
VNG2034H hypothetical protein VNG2034H 41
VNG2112C hypothetical protein VNG2112C 60, 166, 167, 169
VNG2185H hypothetical protein VNG2185H 41
VNG2214G dinF DNA damage-inducible protein 53, 60, 173
VNG2386C hypothetical protein VNG2386C 13, 28
VNG2414H hypothetical protein VNG2414H 18, 38, 64
VNG2466C None 13, 31, 64, 70, 166
VNG2579G idr1 iron-dependent repressor-like protein 21
VNG2632G yusZ2 oxidoreductase 34, 41, 143
VNG5047H None 15, 18, 63
VNG5073H None 13
VNG5120H None 18, 37, 198
VNG6150G orc1 orc / cell division control protein 6 4, 13, 38, 142, 189
VNG6152H hypothetical protein VNG6152H 4, 13, 15, 26, 31, 37, 142, 189, 272, 281, 297
VNG6157H hypothetical protein VNG6157H 18
VNG6170H hypothetical protein VNG6170H 4, 5, 15, 26, 28, 31, 36, 53, 60, 63, 69, 72, 85, 122
VNG6176G kdpA potassium-transporting ATPase subunit A 5, 15, 18, 21, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6178G kdpC potassium-transporting ATPase C chain 5, 15, 18, 26, 28, 31, 47, 51, 53, 62, 63, 69, 70, 72, 74, 177, 279
VNG6183C hypothetical protein VNG6183C 15, 18, 213
VNG6184G cat4 cationic amino acid transporter 15, 18, 213
VNG6185H hypothetical protein VNG6185H 15, 18, 213
VNG6186H hypothetical protein VNG6186H 15, 18, 213
VNG6191H hypothetical protein VNG6191H 17, 30, 34, 38, 41, 44, 80, 91
VNG6193H hypothetical protein VNG6193H 17, 32, 34, 38, 41, 42, 44, 80
VNG6196G phoT2 sodium-dependent phosphate transporter 30, 36, 41, 80, 87, 89
VNG6224H hypothetical protein VNG6224H 18, 91
VNG6258C hypothetical protein VNG6258C 18, 30, 108
VNG6292C hypothetical protein VNG6292C 17, 18, 30, 89
VNG6327H hypothetical protein VNG6327H 41
VNG6344H hypothetical protein VNG6344H 17, 41
VNG6375H hypothetical protein VNG6375H 13, 60, 121, 189
VNG6377H hypothetical protein VNG6377H 13, 60, 121, 189
VNG6378H hypothetical protein VNG6378H 13, 21, 53, 60, 121, 189, 281
VNG6383G lctP L-lactate permease 8, 13, 14
VNG6400H hypothetical protein VNG6400H 18, 30, 80, 133, 245, 290
VNG6411H hypothetical protein VNG6411H 21, 277
VNG6416H hypothetical protein VNG6416H 13, 15, 21, 41, 60, 281
VNG6418H hypothetical protein VNG6418H 13, 18, 21, 41, 60, 281
VNG6419H hypothetical protein VNG6419H 13, 21, 60, 281
VNG6424H hypothetical protein VNG6424H 13, 15, 189
VNG6427H hypothetical protein VNG6427H 17, 18, 30, 62, 74, 89, 107
VNG7011 repH plasmid replication protein RepH 17, 18, 30, 107, 122, 224, 287
VNG7046 hypothetical protein VNG7046 13, 212, 216
VNG7052 hypothetical protein VNG7052 13
VNG7109 hypothetical protein VNG7109 4, 18, 38, 91
VNG7110 hypothetical protein VNG7110 18, 38, 91, 147
VNG7128 hypothetical protein VNG7128 21, 60, 281
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG6418H
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend