Organism : Methanococcus maripaludis S2 | Module List :
MMP1112

hypothetical protein MMP1112

CircVis
Functional Annotations (0)

Warning: No Functional annotations were found!

GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for MMP1112
(Mouseover regulator name to see its description)

MMP1112 is regulated by 17 influences and regulates 0 modules.
Regulators for MMP1112 (17)
Regulator Module Operator
MMP1447 111 tf
MMP0168
MMP0907
129 combiner
MMP0637 129 tf
MMP0787
MMP0907
129 combiner
MMP1023
MMP1303
129 combiner
MMP1303
H2
129 combiner
MMP1376
H2
129 combiner
MMP0033 141 tf
MMP0607 141 tf
MMP0907
MMP1646
141 combiner
MMP1704 141 tf
MMP0033 149 tf
MMP0052
MMP0480
149 combiner
MMP0607 149 tf
MMP0637
MMP0678
149 combiner
MMP1467
MMP1646
149 combiner
MMP1704 149 tf

Warning: MMP1112 Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
879 7.70e+01 atGGTG
Loader icon
880 2.90e+02 gCATCAATCAAAATcTagcgA
Loader icon
911 2.10e+03 tccGCCAC
Loader icon
912 2.40e+04 CCacACcGTGC
Loader icon
933 7.10e+01 ATctctAtTcTttacATtcc
Loader icon
934 6.20e+03 GCAAATCATATTTGGTTTCATAC
Loader icon
947 6.00e-01 taTTaa.cggtGgt
Loader icon
948 1.50e+02 tCTgtcc.tct.gga.gcat
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for MMP1112

Warning: No Functional annotations were found!

Module neighborhood information for MMP1112

MMP1112 has total of 72 gene neighbors in modules 111, 129, 141, 149
Gene neighbors (72)
Gene Common Name Description Module membership
Antisense_13 None 49, 129
MMP0034 GTP cyclohydrolase 130, 149
MMP0036 tfe transcription initiation factor E subunit alpha 49, 87, 92, 129
MMP0072 hypothetical protein MMP0072 28, 129
MMP0078 hypothetical protein MMP0078 12, 111
MMP0079 orotate phosphoribosyltransferase-like protein 12, 111
MMP0131 L-tyrosine decarboxylase 111, 122, 129, 157
MMP0137 dys putative deoxyhypusine synthase 25, 141, 149
MMP0264 MscMJ mechanosensitive ion channel MscS 129, 143
MMP0265 hypothetical protein MMP0265 28, 129
MMP0284 infB translation initiation factor IF-2 25, 149
MMP0296 hypothetical protein MMP0296 4, 129
MMP0319 cbiL precorrin-2 C-20 methyltransferase 24, 140, 141, 149
MMP0320 shikimate kinase 47, 141
MMP0325 glyceraldehyde-3-phosphate dehydrogenase 68, 111
MMP0340 pycB pyruvate carboxylase subunit B 24, 86, 120, 141, 149
MMP0415 O-sialoglycoprotein endopeptidase/protein kinase 47, 149
MMP0554 SAM-binding motif-containing protein 129, 140
MMP0561 cmd carboxymuconolactone decarboxylase 52, 111
MMP0564 hypothetical protein MMP0564 111, 149
MMP0580 act anaerobic ribonucleoside-triphosphate reductase activating protein 115, 129
MMP0602 pyrF orotidine-5'-phosphate decarboxylase 12, 111
MMP0694 beta-lactamase-like protein 51, 109, 149
MMP0706 NAD binding site:UDP-glucose/GDP-mannose dehydrogenase 111, 157
MMP0876 cofG FO synthase subunit 1 1, 129
MMP0881 hypothetical protein MMP0881 111, 137
MMP0883 hypothetical protein MMP0883 115, 129
MMP0905 hypothetical protein MMP0905 14, 149
MMP0906 ribonuclease Z 129, 149
MMP0907 transcriptional regulator TrmB 14, 149
MMP0919 dihydroorotate dehydrogenase electron transfer subunit 86, 141
MMP0920 ahcY S-adenosyl-L-homocysteine hydrolase 80, 141
MMP0921 RNAse P, Rpr2/Rpp21 subunit 25, 141
MMP0941 hypothetical protein MMP0941 129, 149
MMP0942 hypothetical protein MMP0942 111, 115
MMP0943 taqD glycerol-3-phosphate cytidyltransferase 92, 111
MMP0953 cbiH precorrin-3B C17-methyltransferase 24, 25, 149
MMP0970 lig DNA ligase I, ATP-dependent Dnl1 47, 129
MMP0989 top6B DNA topoisomerase VI subunit B 139, 141
MMP1011 gltX glutamyl-tRNA synthetase 25, 129
MMP1014 radical SAM domain-containing protein 25, 141
MMP1085 hypothetical protein MMP1085 141, 143, 149
MMP1086 hypothetical protein MMP1086 122, 141
MMP1107 Signal recognition particle protein SRP19 111, 141
MMP1108 corA magnesium/cobalt transporter CorA 141, 149
MMP1109 hypothetical protein MMP1109 111, 129
MMP1112 hypothetical protein MMP1112 111, 129, 141, 149
MMP1121 metal-dependent phophohydrolase-like protein 129, 157
MMP1265 glutamyl-tRNA(Gln) amidotransferase subunit E 28, 129
MMP1307 methyltransferase-like protein 4, 149
MMP1313 fen-1 flap endonuclease-1 47, 52, 141
MMP1327 rpoK RNA polymerase Rpb6 103, 139, 149
MMP1328 enolase 103, 139, 149
MMP1334 solute-binding protein/glutamate receptor 41, 129
MMP1344 hypothetical protein MMP1344 111, 157
MMP1345 undecaprenyl pyrophospahte synthetase-like protein 49, 111
MMP1356 PP-loop domain-containing protein 25, 129, 139, 140, 149
MMP1357 hypothetical protein MMP1357 140, 149
MMP1361 rpoB2 DNA-directed RNA polymerase subunit beta'' 25, 92, 109, 149
MMP1440 tRNA-modifying protein 129, 137
MMP1467 ehaT hypothetical protein MMP1467 28, 129, 133
MMP1470 pdfA prefoldin subunit alpha 7, 111
MMP1491 trzA amidohydrolase 14, 111, 122, 149
MMP1492 pyrE orotate phosphoribosyltransferase 14, 149
MMP1521 hypothetical protein MMP1521 14, 111, 122, 157
MMP1582 pdaD pyruvoyl-dependent arginine decarboxylase 87, 149
MMP1600 ribosomal protein S6 modification protein 104, 129
MMP1614 hisS histidyl-tRNA synthetase 141, 149
MMP1630 ABC transporter ATPase 129, 133
MMP1659 pyrB aspartate carbamoyltransferase catalytic subunit 24, 111, 122
MMP1722 hisF imidazole glycerol phosphate synthase subunit HisF 111, 115
Unanno_61 None 111, 129
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for MMP1112
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend