Organism : Halobacterium salinarum NRC-1 | Module List :
VNG1264C

hypothetical protein VNG1264C

CircVis
Functional Annotations (1)
Function System
Uncharacterized protein conserved in archaea cog/ cog
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG1264C
(Mouseover regulator name to see its description)

VNG1264C is regulated by 31 influences and regulates 0 modules.
Regulators for VNG1264C (31)
Regulator Module Operator
VNG0194H 25 tf
VNG0458G
VNG2641H
25 combiner
VNG1899G
VNG2243G
25 combiner
VNG1899G
VNG2641H
25 combiner
VNG2243G
VNG0293H
25 combiner
VNG2441G
VNG2641H
25 combiner
VNG0254G
VNG0156C
84 combiner
VNG0254G
VNG1405C
84 combiner
VNG0835G
VNG0254G
84 combiner
VNG1123G
VNG0156C
84 combiner
VNG1426H
VNG2641H
84 combiner
VNG1786H
VNG2641H
84 combiner
VNG2641H 84 tf
VNG5182G 84 tf
VNG0039H
VNG1405C
9 combiner
VNG0293H 9 tf
VNG0462C
VNG2641H
9 combiner
VNG0651G
VNG2641H
9 combiner
VNG0835G
VNG1123G
9 combiner
VNG1123G
VNG0156C
9 combiner
VNG1123G
VNG1405C
9 combiner
VNG1405C
VNG2641H
9 combiner
VNG1426H
VNG2641H
9 combiner
VNG5182G 9 tf
VNG0040C
VNG0293H
55 combiner
VNG0258H
VNG0751C
55 combiner
VNG0734G
VNG2641H
55 combiner
VNG1029C
VNG2641H
55 combiner
VNG1899G
VNG0258H
55 combiner
VNG1899G
VNG0293H
55 combiner
VNG2243G
VNG0293H
55 combiner

Warning: VNG1264C Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 8 motifs predicted.

Motif Table (8)
Motif Id e-value Consensus Motif Logo
997 2.30e-05 AcCCAAaCtcATgGGGtaT
Loader icon
998 1.60e+00 AaTCAatTtacTagAaagaCC
Loader icon
1027 8.00e+00 TACATGGTACAACTAGATAATTAA
Loader icon
1028 5.20e+02 GgGTtcCcGtcgGaGgCaAAaAC
Loader icon
1085 1.50e+03 gTCGTTCC
Loader icon
1086 2.60e+03 AagATaAAaAtG
Loader icon
1143 0.00e+00 aaactgatTggGtgcTttaGtTgC
Loader icon
1144 3.70e+01 AACacCcAAaCAcAT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG1264C

VNG1264C is enriched for 1 functions in 3 categories.
Enrichment Table (1)
Function System
Uncharacterized protein conserved in archaea cog/ cog
Module neighborhood information for VNG1264C

VNG1264C has total of 71 gene neighbors in modules 9, 25, 55, 84
Gene neighbors (71)
Gene Common Name Description Module membership
VNG0174G cat1 cationic amino acid transporter 9, 223, 244
VNG0195H hypothetical protein VNG0195H 84, 289
VNG0226G htrA hypothetical protein VNG0226G 9, 187
VNG0227H hypothetical protein VNG0227H 25, 55
VNG0254G tfbG transcription initiation factor IIB 3, 12, 25, 50, 55, 113
VNG0261H hypothetical protein VNG0261H 7, 12, 16, 25, 49, 50, 55, 79, 109, 113
VNG0262C hypothetical protein VNG0262C 12, 25, 49, 50, 55, 79, 109, 113
VNG0264H hypothetical protein VNG0264H 55, 109
VNG0293H hypothetical protein VNG0293H 84
VNG0321G ids Ids 7, 25, 50, 55
VNG0402H hypothetical protein VNG0402H 73, 84
VNG0533H hypothetical protein VNG0533H 25, 50
VNG0654C hypothetical protein VNG0654C 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0737H hypothetical protein VNG0737H 9, 244, 273
VNG0828H hypothetical protein VNG0828H 9, 11, 73, 84, 125, 208, 223, 240, 244, 273, 289
VNG0829G dmsA dimethylsulfoxide reductase 9, 11, 73, 84, 125, 208, 223, 240, 244, 273, 289
VNG0830G hmoA HmoA 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0831G moz molybdopterin oxidoreductase 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0832C hypothetical protein VNG0832C 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG0932C hypothetical protein VNG0932C 25, 50, 61
VNG0940Gm ACS3 Acetyl-CoA synthetase 7, 19, 24, 25, 29, 49
VNG0955G fapE flagella-like protein E 7, 16, 25, 50, 100, 291
VNG0973G cheB hypothetical protein VNG0973G 55, 61, 184
VNG0974G cheY hypothetical protein VNG0974G 7, 55, 61, 184
VNG0976G cheW1 chemotaxis protein 7, 55
VNG0997G acs2 acetyl-CoA synthetase 9, 73, 84
VNG1120H hypothetical protein VNG1120H 9, 187
VNG1200H hypothetical protein VNG1200H 9, 73, 84, 223, 244
VNG1213C hypothetical protein VNG1213C 84, 283
VNG1264C hypothetical protein VNG1264C 9, 25, 55, 84
VNG1273G moaC putative molybdenum cofactor biosynthesis protein MoaC 25, 81
VNG1314H hypothetical protein VNG1314H 9, 84
VNG1315H hypothetical protein VNG1315H 84
VNG1326H hypothetical protein VNG1326H 25, 50, 55
VNG1380H hypothetical protein VNG1380H 9, 73, 84, 223
VNG1446H hypothetical protein VNG1446H 25, 55
VNG1458G crtB1 phytoene synthase 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1459H hypothetical protein VNG1459H 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1461H hypothetical protein VNG1461H 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1462G cdc48a cell division cycle protein 9, 11, 73, 84, 125, 208, 223, 244, 273
VNG1463G blp bacterio-opsin linked protein 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1464G bat bacterio-opsin activator 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1465G brp bacteriorhodopsin-like protein 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1467G bop bacterio-opsin 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1468H hypothetical protein VNG1468H 9, 11, 73, 84, 125, 208, 223, 244, 273, 289
VNG1536C hypothetical protein VNG1536C 84
VNG1663C hypothetical protein VNG1663C 25, 50
VNG1664H hypothetical protein VNG1664H 25, 50
VNG1676G gbp2 GTP-binding protein 84
VNG1806H hypothetical protein VNG1806H 9, 242
VNG1826H hypothetical protein VNG1826H 9, 73
VNG1898C hypothetical protein VNG1898C 25, 50, 55
VNG1933G ftsZ3 cell division protein 7, 25, 61, 227
VNG2008H hypothetical protein VNG2008H 9, 49, 79, 113, 170, 187
VNG2014H hypothetical protein VNG2014H 9, 73, 208, 223
VNG2195G coxB2 cytochrome c oxidase subunit II 25, 50
VNG2196G hcpB halocyanin-like protein 25, 50
VNG2259C phosphoenolpyruvate carboxylase 25, 50
VNG2310H hypothetical protein VNG2310H 25, 229
VNG2311H hypothetical protein VNG2311H 25, 229
VNG2413H hypothetical protein VNG2413H 9, 84, 113, 242
VNG2432C hypothetical protein VNG2432C 25, 50
VNG2499G gcdH glutaryl-CoA dehydrogenase 7, 24, 25, 50, 61, 78
VNG2508C hypothetical protein VNG2508C 25, 50, 55
VNG2535H hypothetical protein VNG2535H 9, 11, 73, 125, 208, 223, 244, 273
VNG2603H hypothetical protein VNG2603H 25, 61
VNG2604Gm THI1 ribulose-1,5-biphosphate synthetase 25, 61
VNG2606G thiD hypothetical protein VNG2606G 25, 61
VNG2644C hypothetical protein VNG2644C 25, 50
VNG5053H None 9
VNG6223C hypothetical protein VNG6223C 9, 187
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG1264C
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend