Organism : Halobacterium salinarum NRC-1
| Module List :
![](/static/images/help.png)
VNG1264C
hypothetical protein VNG1264C
Functional Annotations (1)
Function | System |
---|---|
Uncharacterized protein conserved in archaea | cog/ cog |
![](/static/images/help.png)
Regulation information for VNG1264C
(Mouseover regulator name to see its description)
Regulator | Module | Operator |
---|---|---|
VNG0194H | 25 | tf |
VNG0458G VNG2641H |
25 | combiner |
VNG1899G VNG2243G |
25 | combiner |
VNG1899G VNG2641H |
25 | combiner |
VNG2243G VNG0293H |
25 | combiner |
VNG2441G VNG2641H |
25 | combiner |
VNG0039H VNG1405C |
9 | combiner |
VNG0293H | 9 | tf |
VNG0462C VNG2641H |
9 | combiner |
VNG0651G VNG2641H |
9 | combiner |
VNG0835G VNG1123G |
9 | combiner |
VNG1123G VNG0156C |
9 | combiner |
VNG1123G VNG1405C |
9 | combiner |
VNG1405C VNG2641H |
9 | combiner |
VNG1426H VNG2641H |
9 | combiner |
VNG5182G | 9 | tf |
VNG0254G VNG0156C |
84 | combiner |
VNG0254G VNG1405C |
84 | combiner |
VNG0835G VNG0254G |
84 | combiner |
VNG1123G VNG0156C |
84 | combiner |
VNG1426H VNG2641H |
84 | combiner |
VNG1786H VNG2641H |
84 | combiner |
VNG2641H | 84 | tf |
VNG5182G | 84 | tf |
VNG0040C VNG0293H |
55 | combiner |
VNG0258H VNG0751C |
55 | combiner |
VNG0734G VNG2641H |
55 | combiner |
VNG1029C VNG2641H |
55 | combiner |
VNG1899G VNG0258H |
55 | combiner |
VNG1899G VNG0293H |
55 | combiner |
VNG2243G VNG0293H |
55 | combiner |
![](/static/images/help.png)
Motif information (de novo identified motifs for modules)
There are 8 motifs predicted.
Motif Id | e-value | Consensus | Motif Logo |
---|---|---|---|
997 | 2.30e-05 | AcCCAAaCtcATgGGGtaT |
![]() |
998 | 1.60e+00 | AaTCAatTtacTagAaagaCC |
![]() |
1027 | 8.00e+00 | TACATGGTACAACTAGATAATTAA |
![]() |
1028 | 5.20e+02 | GgGTtcCcGtcgGaGgCaAAaAC |
![]() |
1085 | 1.50e+03 | gTCGTTCC |
![]() |
1086 | 2.60e+03 | AagATaAAaAtG |
![]() |
1143 | 0.00e+00 | aaactgatTggGtgcTttaGtTgC |
![]() |
1144 | 3.70e+01 | AACacCcAAaCAcAT |
![]() |
![](/static/images/help.png)
Functional Enrichment for VNG1264C
Function | System |
---|---|
Uncharacterized protein conserved in archaea | cog/ cog |
![](/static/images/help.png)
Module neighborhood information for VNG1264C
Gene | Common Name | Description | Module membership |
---|---|---|---|
VNG0174G | cat1 | cationic amino acid transporter | 9, 223, 244 |
VNG0195H | hypothetical protein VNG0195H | 84, 289 | |
VNG0226G | htrA | hypothetical protein VNG0226G | 9, 187 |
VNG0227H | hypothetical protein VNG0227H | 25, 55 | |
VNG0254G | tfbG | transcription initiation factor IIB | 3, 12, 25, 50, 55, 113 |
VNG0261H | hypothetical protein VNG0261H | 7, 12, 16, 25, 49, 50, 55, 79, 109, 113 | |
VNG0262C | hypothetical protein VNG0262C | 12, 25, 49, 50, 55, 79, 109, 113 | |
VNG0264H | hypothetical protein VNG0264H | 55, 109 | |
VNG0293H | hypothetical protein VNG0293H | 84 | |
VNG0321G | ids | Ids | 7, 25, 50, 55 |
VNG0402H | hypothetical protein VNG0402H | 73, 84 | |
VNG0533H | hypothetical protein VNG0533H | 25, 50 | |
VNG0654C | hypothetical protein VNG0654C | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 | |
VNG0737H | hypothetical protein VNG0737H | 9, 244, 273 | |
VNG0828H | hypothetical protein VNG0828H | 9, 11, 73, 84, 125, 208, 223, 240, 244, 273, 289 | |
VNG0829G | dmsA | dimethylsulfoxide reductase | 9, 11, 73, 84, 125, 208, 223, 240, 244, 273, 289 |
VNG0830G | hmoA | HmoA | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG0831G | moz | molybdopterin oxidoreductase | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG0832C | hypothetical protein VNG0832C | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 | |
VNG0932C | hypothetical protein VNG0932C | 25, 50, 61 | |
VNG0940Gm | ACS3 | Acetyl-CoA synthetase | 7, 19, 24, 25, 29, 49 |
VNG0955G | fapE | flagella-like protein E | 7, 16, 25, 50, 100, 291 |
VNG0973G | cheB | hypothetical protein VNG0973G | 55, 61, 184 |
VNG0974G | cheY | hypothetical protein VNG0974G | 7, 55, 61, 184 |
VNG0976G | cheW1 | chemotaxis protein | 7, 55 |
VNG0997G | acs2 | acetyl-CoA synthetase | 9, 73, 84 |
VNG1120H | hypothetical protein VNG1120H | 9, 187 | |
VNG1200H | hypothetical protein VNG1200H | 9, 73, 84, 223, 244 | |
VNG1213C | hypothetical protein VNG1213C | 84, 283 | |
VNG1264C | hypothetical protein VNG1264C | 9, 25, 55, 84 | |
VNG1273G | moaC | putative molybdenum cofactor biosynthesis protein MoaC | 25, 81 |
VNG1314H | hypothetical protein VNG1314H | 9, 84 | |
VNG1315H | hypothetical protein VNG1315H | 84 | |
VNG1326H | hypothetical protein VNG1326H | 25, 50, 55 | |
VNG1380H | hypothetical protein VNG1380H | 9, 73, 84, 223 | |
VNG1446H | hypothetical protein VNG1446H | 25, 55 | |
VNG1458G | crtB1 | phytoene synthase | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG1459H | hypothetical protein VNG1459H | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 | |
VNG1461H | hypothetical protein VNG1461H | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 | |
VNG1462G | cdc48a | cell division cycle protein | 9, 11, 73, 84, 125, 208, 223, 244, 273 |
VNG1463G | blp | bacterio-opsin linked protein | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG1464G | bat | bacterio-opsin activator | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG1465G | brp | bacteriorhodopsin-like protein | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG1467G | bop | bacterio-opsin | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 |
VNG1468H | hypothetical protein VNG1468H | 9, 11, 73, 84, 125, 208, 223, 244, 273, 289 | |
VNG1536C | hypothetical protein VNG1536C | 84 | |
VNG1663C | hypothetical protein VNG1663C | 25, 50 | |
VNG1664H | hypothetical protein VNG1664H | 25, 50 | |
VNG1676G | gbp2 | GTP-binding protein | 84 |
VNG1806H | hypothetical protein VNG1806H | 9, 242 | |
VNG1826H | hypothetical protein VNG1826H | 9, 73 | |
VNG1898C | hypothetical protein VNG1898C | 25, 50, 55 | |
VNG1933G | ftsZ3 | cell division protein | 7, 25, 61, 227 |
VNG2008H | hypothetical protein VNG2008H | 9, 49, 79, 113, 170, 187 | |
VNG2014H | hypothetical protein VNG2014H | 9, 73, 208, 223 | |
VNG2195G | coxB2 | cytochrome c oxidase subunit II | 25, 50 |
VNG2196G | hcpB | halocyanin-like protein | 25, 50 |
VNG2259C | phosphoenolpyruvate carboxylase | 25, 50 | |
VNG2310H | hypothetical protein VNG2310H | 25, 229 | |
VNG2311H | hypothetical protein VNG2311H | 25, 229 | |
VNG2413H | hypothetical protein VNG2413H | 9, 84, 113, 242 | |
VNG2432C | hypothetical protein VNG2432C | 25, 50 | |
VNG2499G | gcdH | glutaryl-CoA dehydrogenase | 7, 24, 25, 50, 61, 78 |
VNG2508C | hypothetical protein VNG2508C | 25, 50, 55 | |
VNG2535H | hypothetical protein VNG2535H | 9, 11, 73, 125, 208, 223, 244, 273 | |
VNG2603H | hypothetical protein VNG2603H | 25, 61 | |
VNG2604Gm | THI1 | ribulose-1,5-biphosphate synthetase | 25, 61 |
VNG2606G | thiD | hypothetical protein VNG2606G | 25, 61 |
VNG2644C | hypothetical protein VNG2644C | 25, 50 | |
VNG5053H | None | 9 | |
VNG6223C | hypothetical protein VNG6223C | 9, 187 |
Gene Page Help
Network Tab
If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.
Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.
Regulation Tab
Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.
If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.
You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".
For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.
Motifs Tab
Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.
Functions Tab
Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.
Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.
Module Members Tab
Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.
Help Tab
This help page. More general help can be accessed by clicking help menu in the main navigation bar.
CircVis
Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;![](/static/images/help_images/circvis-help.png)
- 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
- 2. Source gene
- 3. Target genes (other module members)
- 4. Interactions between source and target genes for a particular module
- 5. Module(s) that source gene and target genes belong to
- 6. Visualisation legend
Social Tab
Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.
Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.
In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.