Organism : Halobacterium salinarum NRC-1 | Module List :
VNG2499G gcdH

glutaryl-CoA dehydrogenase

CircVis
Functional Annotations (10)
Function System
Acyl-CoA dehydrogenases cog/ cog
glutaryl-CoA dehydrogenase activity go/ molecular_function
electron transport go/ biological_process
flavin adenine dinucleotide binding go/ molecular_function
Fatty acid metabolism kegg/ kegg pathway
Lysine degradation kegg/ kegg pathway
Benzoate degradation kegg/ kegg pathway
Tryptophan metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Microbial metabolism in diverse environments kegg/ kegg pathway
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG2499G
(Mouseover regulator name to see its description)

VNG2499G is regulated by 33 influences and regulates 0 modules.
Regulators for VNG2499G gcdH (33)
Regulator Module Operator
VNG0101G
VNG2163H
24 combiner
VNG0194H 24 tf
VNG2661G
VNG1029C
24 combiner
VNG0254G 7 tf
VNG0536G
VNG0258H
7 combiner
VNG1836G
VNG1899G
7 combiner
VNG1899G
VNG0258H
7 combiner
VNG5028G
VNG0258H
7 combiner
VNG0194H 25 tf
VNG0458G
VNG2641H
25 combiner
VNG1899G
VNG2243G
25 combiner
VNG1899G
VNG2641H
25 combiner
VNG2243G
VNG0293H
25 combiner
VNG2441G
VNG2641H
25 combiner
VNG0458G
VNG2163H
50 combiner
VNG0458G
VNG2641H
50 combiner
VNG1029C
VNG2641H
50 combiner
VNG1836G
VNG0458G
50 combiner
VNG1899G
VNG0258H
50 combiner
VNG1899G
VNG2243G
50 combiner
VNG1899G
VNG2641H
50 combiner
VNG2243G
VNG0293H
50 combiner
VNG2243G
VNG0751C
50 combiner
VNG2441G
VNG0258H
50 combiner
VNG0194H 78 tf
VNG0258H 78 tf
VNG0536G
VNG0258H
78 combiner
VNG1836G 78 tf
VNG1836G
VNG1899G
78 combiner
VNG1836G
VNG2441G
78 combiner
VNG0101G
VNG2441G
61 combiner
VNG1899G
VNG1029C
61 combiner
VNG1899G
VNG2243G
61 combiner

Warning: VNG2499G Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 12 motifs predicted.

Motif Table (12)
Motif Id e-value Consensus Motif Logo
993 1.30e+01 ttggtGataaTcgat
Loader icon
994 7.70e+02 GAtAat..tCaactGTt.gtaA
Loader icon
1025 3.90e-02 tttaaaacgtTtgc
Loader icon
1026 8.10e+02 cACgaAgA.cc
Loader icon
1027 8.00e+00 TACATGGTACAACTAGATAATTAA
Loader icon
1028 5.20e+02 GgGTtcCcGtcgGaGgCaAAaAC
Loader icon
1077 1.60e-01 taa.ATaAatA
Loader icon
1078 3.00e+03 cttCGAGcacacgcAgGagca
Loader icon
1097 1.30e-01 gGcaCCCaAcACgct.a.ca
Loader icon
1098 3.60e+00 TACATGGTACAACTAGATAATTAA
Loader icon
1131 2.00e-04 aTTtTc.Gtga
Loader icon
1132 3.90e+00 TtcgAgtacATcA
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG2499G

VNG2499G is enriched for 10 functions in 3 categories.
Enrichment Table (10)
Function System
Acyl-CoA dehydrogenases cog/ cog
glutaryl-CoA dehydrogenase activity go/ molecular_function
electron transport go/ biological_process
flavin adenine dinucleotide binding go/ molecular_function
Fatty acid metabolism kegg/ kegg pathway
Lysine degradation kegg/ kegg pathway
Benzoate degradation kegg/ kegg pathway
Tryptophan metabolism kegg/ kegg pathway
Metabolic pathways kegg/ kegg pathway
Microbial metabolism in diverse environments kegg/ kegg pathway
Module neighborhood information for VNG2499G

VNG2499G has total of 113 gene neighbors in modules 7, 24, 25, 50, 61, 78
Gene neighbors (113)
Gene Common Name Description Module membership
VNG0192G ftsZ2 cell division protein FtsZ 2, 3, 7, 12, 16, 49, 50, 71, 78, 79, 123
VNG0194H hypothetical protein VNG0194H 3, 7, 12, 16, 50, 79, 123
VNG0207H hypothetical protein VNG0207H 2, 3, 7, 12, 16, 49, 67, 71, 78, 79, 113, 123
VNG0208H hypothetical protein VNG0208H 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123
VNG0209H hypothetical protein VNG0209H 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123
VNG0227H hypothetical protein VNG0227H 25, 55
VNG0254G tfbG transcription initiation factor IIB 3, 12, 25, 50, 55, 113
VNG0259G ipp inorganic pyrophosphatase 7, 12, 16, 79, 109
VNG0261H hypothetical protein VNG0261H 7, 12, 16, 25, 49, 50, 55, 79, 109, 113
VNG0262C hypothetical protein VNG0262C 12, 25, 49, 50, 55, 79, 109, 113
VNG0303G lon ATP-dependent protease Lon 78
VNG0321G ids Ids 7, 25, 50, 55
VNG0524G yurY ABC transporter ATP-binding protein 2, 3, 7, 12, 16, 71, 113, 225
VNG0525C hypothetical protein VNG0525C 7, 12, 71, 78, 113, 225
VNG0527C hypothetical protein VNG0527C 2, 3, 7, 12, 16, 71, 78, 79, 113, 123, 225
VNG0533H hypothetical protein VNG0533H 25, 50
VNG0584H hypothetical protein VNG0584H 2, 16, 24
VNG0585H hypothetical protein VNG0585H 2, 16, 24
VNG0635G nolB NADH dehydrogenase/oxidoreductase-like protein 2, 16, 19, 24, 29, 199
VNG0636G ndhG1 NADH dehydrogenase/oxidoreductase 19, 24, 29
VNG0637G ndhG5 NADH dehydrogenase/oxidoreductase 2, 16, 19, 24, 29
VNG0639G ndhG4 NADH dehydrogenase/oxidoreductase 19, 24, 29, 199
VNG0640G nolD NADH dehydrogenase/oxidoreductase-like protein 2, 3, 16, 19, 24, 29, 45, 123
VNG0641C NADH dehydrogenase subunit J 19, 24, 29, 45, 199
VNG0642C hypothetical protein VNG0642C 2, 24, 29, 45
VNG0796G cgs cystathionine gamma synthase/lyase 7, 50
VNG0931G acaB2 3-ketoacyl-CoA thiolase 50, 283
VNG0932C hypothetical protein VNG0932C 25, 50, 61
VNG0940Gm ACS3 Acetyl-CoA synthetase 7, 19, 24, 25, 29, 49
VNG0946G minD1 cell division inhibitor 7
VNG0949G gspE3 type II secretion system protein 7
VNG0954C hypothetical protein VNG0954C 7, 278, 283
VNG0955G fapE flagella-like protein E 7, 16, 25, 50, 100, 291
VNG0960G flaB1 flagellin B1 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123
VNG0961G flaB2 flagellin B2 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123, 291
VNG0962G flaB3 flagellin B3 2, 3, 7, 12, 16, 49, 78, 100, 113, 123
VNG0964C hypothetical protein VNG0964C 12, 24, 49, 100, 109
VNG0967Gm cheD chemotaxis protein 61, 184
VNG0970G cheC1 chemotaxis protein 61, 184
VNG0971G cheA hypothetical protein VNG0971G 61, 184
VNG0973G cheB hypothetical protein VNG0973G 55, 61, 184
VNG0974G cheY hypothetical protein VNG0974G 7, 55, 61, 184
VNG0976G cheW1 chemotaxis protein 7, 55
VNG1008G flaA1a flagellin A1 78, 81
VNG1125G korB KorB 7, 12, 24, 29
VNG1128G korA KorA 3, 7, 12, 24, 29, 49, 71, 78, 113
VNG1190G sod1 superoxide dismutase 78, 283
VNG1264C hypothetical protein VNG1264C 9, 25, 55, 84
VNG1273G moaC putative molybdenum cofactor biosynthesis protein MoaC 25, 81
VNG1292H hypothetical protein VNG1292H 24, 33
VNG1306G sdhA hypothetical protein VNG1306G 2, 3, 12, 16, 78, 79, 90, 100
VNG1310G sdhC hypothetical protein VNG1310G 2, 24, 236
VNG1326H hypothetical protein VNG1326H 25, 50, 55
VNG1408G ush UDP-sugar hydrolase 61
VNG1413H hypothetical protein VNG1413H 61
VNG1414G glyA serine hydroxymethyltransferase 61
VNG1446H hypothetical protein VNG1446H 25, 55
VNG1554G cbiG cobalamin biosynthesis protein CbiG 45, 61, 67, 114, 124, 227
VNG1557G cbiH cobalamin biosynthesis protein 45, 61, 67, 114, 124, 174, 227
VNG1558H hypothetical protein VNG1558H 45, 61, 67, 114, 124, 174, 227
VNG1566G cobN hypothetical protein VNG1566G 61, 124
VNG1567G cbiC precorrin isomerase 61, 114, 124
VNG1568G cbiJ cobalt-precorrin-6Y C(5)-methyltransferase 61, 114, 124
VNG1663C hypothetical protein VNG1663C 25, 50
VNG1664H hypothetical protein VNG1664H 25, 50
VNG1768G eif5a translation initiation factor IF-5A 23, 24, 40, 59
VNG1898C hypothetical protein VNG1898C 25, 50, 55
VNG1933G ftsZ3 cell division protein 7, 25, 61, 227
VNG2081H hypothetical protein VNG2081H 49, 50, 123, 175, 187
VNG2104G pchB potassium channel-like protein 50, 275
VNG2122G ilvE2 branched-chain amino acid aminotransferase 7, 19, 29, 49, 71, 75, 78
VNG2139G atpA V-type ATP synthase subunit A 23, 24, 33, 39, 45, 67, 114, 124, 227
VNG2142G atpE V-type ATP synthase subunit E 19, 24, 45, 67, 114, 227
VNG2143G atpK H+-transporting ATP synthase subunit K 2, 19, 23, 24, 45, 67, 75, 114, 124, 227
VNG2144G atpI H+-transporting ATP synthase subunit I 19, 23, 24, 45, 67, 75, 124, 227
VNG2146H hypothetical protein VNG2146H 2, 16, 19, 24, 45, 67, 124, 227
VNG2151G etfA electron transfer flavoprotein subunit alpha 33, 45, 61, 124
VNG2193Gm coxA1 cytochrome c oxidase subunit I 50
VNG2195G coxB2 cytochrome c oxidase subunit II 25, 50
VNG2196G hcpB halocyanin-like protein 25, 50
VNG2217G pdhA2 pyruvate dehydrogenase alpha subunit 45, 61, 124
VNG2218G pdhB hypothetical protein VNG2218G 45, 61, 124, 174
VNG2219G dsa branched-chain alpha-keto acid dehydrogenase subunit E2 45, 61, 124, 174
VNG2220G lpdA LpdA 45, 61, 124, 174, 184
VNG2226G cctA thermosome subunit alpha 3, 7, 12, 29, 49, 50, 52, 78, 113
VNG2243G tbpE transcription factor 19, 24, 29, 128
VNG2244H hypothetical protein VNG2244H 24, 29
VNG2251G achY S-adenosyl-L-homocysteine hydrolase 24, 29, 49, 71, 79, 113
VNG2259C phosphoenolpyruvate carboxylase 25, 50
VNG2310H hypothetical protein VNG2310H 25, 229
VNG2311H hypothetical protein VNG2311H 25, 229
VNG2349G dppA hypothetical protein VNG2349G 61
VNG2377G nosY hypothetical protein VNG2377G 50, 90
VNG2400H hypothetical protein VNG2400H 61, 184
VNG2430G thrC1 threonine synthase 61, 77
VNG2432C hypothetical protein VNG2432C 25, 50
VNG2499G gcdH glutaryl-CoA dehydrogenase 7, 24, 25, 50, 61, 78
VNG2508C hypothetical protein VNG2508C 25, 50, 55
VNG2539H hypothetical protein VNG2539H 7, 29, 78
VNG2543C hypothetical protein VNG2543C 3, 12, 49, 71, 78, 113, 156
VNG2603H hypothetical protein VNG2603H 25, 61
VNG2604Gm THI1 ribulose-1,5-biphosphate synthetase 25, 61
VNG2606G thiD hypothetical protein VNG2606G 25, 61
VNG2617G adh2 alcohol dehydrogenase 50
VNG2644C hypothetical protein VNG2644C 25, 50
VNG2648G rps10p 30S ribosomal protein S10P 2, 3, 16, 23, 24, 29, 40, 110
VNG2649G eef1a elongation factor 1-alpha 2, 3, 16, 24, 29, 40, 79, 110
VNG5049H None 50
VNG6294G perA peroxidase / catalase 23, 24, 29, 52
VNG6312G argS arginine-tRNA synthetase 24, 29
VNG6313G nhaC3 Na+/H+ antiporter 2, 3, 12, 16, 50, 113
VNG7027 gvpN gas vesicle protein GvpN 78
VNG7039 cydA cytochrome d ubiquinol oxidase subunit I 50
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG2499G
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend