Organism : Methanococcus maripaludis S2
| Module List :
Regulation information for MMP0239
(Mouseover regulator name to see its description)
| Regulator | Module | Operator |
|---|---|---|
| H2 | 49 | ef |
| MMP0460 | 49 | tf |
| MMP0499 MMP1065 |
49 | combiner |
| MMP0018 MMP0402 |
75 | combiner |
| MMP0097 MMP0631 |
75 | combiner |
| MMP0209 | 75 | tf |
| MMP0402 MMP1015 |
75 | combiner |
| MMP1023 | 75 | tf |
| MMP0032 MMP0257 |
1 | combiner |
| MMP0209 | 1 | tf |
| MMP1447 | 1 | tf |
| MMP0041 MMP1023 |
106 | combiner |
| MMP0460 MMP0799 |
106 | combiner |
| MMP0568 H2 |
106 | combiner |
| MMP0799 MMP1065 |
106 | combiner |
| MMP1065 | 106 | tf |
Motif information (de novo identified motifs for modules)
There are 8 motifs predicted.
| Motif Id | e-value | Consensus | Motif Logo |
|---|---|---|---|
| 663 | 3.00e+01 | CgacCC.c.agG |
![]() |
| 664 | 7.60e+03 | CcgcTg |
![]() |
| 759 | 1.20e+00 | tagATatattGgtGa |
![]() |
| 760 | 1.90e+01 | caAgTcTGgTGg |
![]() |
| 811 | 9.70e-01 | CCcctCcg |
![]() |
| 812 | 7.10e+03 | aAAAtA.ccGA |
![]() |
| 869 | 1.10e+03 | CGAGTAAACCGGATAGCTTAC |
![]() |
| 870 | 5.60e+03 | TGaagGGCaGtggcA |
![]() |
Module neighborhood information for MMP0239
| Gene | Common Name | Description | Module membership |
|---|---|---|---|
| Antisense_13 | None | 49, 129 | |
| Antisense_2 | None | 1, 22 | |
| Antisense_23 | None | 1, 117 | |
| Antisense_24 | None | 5, 49, 90 | |
| Antisense_5 | None | 1, 22 | |
| MMP0001 | hypothetical protein MMP0001 | 46, 106, 121, 144 | |
| MMP0002 | L-seryl-tRNA selenium transferase | 12, 46, 76, 106, 121 | |
| MMP0008 | DP1 | DNA polymerase II small subunit | 22, 75, 142 |
| MMP0009 | putative DNA primase large subunit | 75, 151 | |
| MMP0020 | nickel responsive regulator | 49, 123 | |
| MMP0030 | MCM family DNA replication protein | 106, 117 | |
| MMP0036 | tfe | transcription initiation factor E subunit alpha | 49, 87, 92, 129 |
| MMP0063 | argB | acetylglutamate kinase | 49, 151 |
| MMP0084 | hypothetical protein MMP0084 | 49, 106 | |
| MMP0085 | hypothetical protein MMP0085 | 22, 106 | |
| MMP0091 | hypothetical protein MMP0091 | 51, 106 | |
| MMP0113 | hypothetical protein MMP0113 | 23, 75, 142 | |
| MMP0119 | birA | biotin--acetyl-CoA-carboxylase ligase | 1, 75, 142 |
| MMP0153 | aksA | trans-homoaconitate synthase | 1, 143 |
| MMP0154 | hypothetical protein MMP0154 | 1, 13 | |
| MMP0166 | MATE family drug/sodium antiporter | 1, 28 | |
| MMP0167 | ABC transporter ATP-binding protein | 1, 28 | |
| MMP0168 | ParR family transcriptional regulator | 1, 28 | |
| MMP0176 | cell division protein CDC48 | 1, 46 | |
| MMP0180 | ribC | riboflavin synthase | 1, 58 |
| MMP0235 | hypothetical protein MMP0235 | 75, 160 | |
| MMP0236 | hypothetical protein MMP0236 | 75, 104 | |
| MMP0237 | hypothetical protein MMP0237 | 75, 160 | |
| MMP0239 | hypothetical protein MMP0239 | 1, 49, 75, 106 | |
| MMP0240 | hypothetical protein MMP0240 | 75, 160 | |
| MMP0241 | hypothetical protein MMP0241 | 65, 75 | |
| MMP0268 | truA | tRNA pseudouridine synthase A | 49, 51 |
| MMP0277 | TraB family protein | 49, 90 | |
| MMP0279 | mptG | beta-ribofuranosylaminobenzene 5'-phosphate synthase family protein | 49, 90 |
| MMP0302 | hypothetical protein MMP0302 | 49, 90 | |
| MMP0307 | hypothetical protein MMP0307 | 33, 49, 153 | |
| MMP0392 | purD | phosphoribosylamine--glycine ligase | 4, 75, 104 |
| MMP0420 | CBS domain-containing protein | 13, 106 | |
| MMP0425 | hypothetical protein MMP0425 | 57, 102, 106 | |
| MMP0426 | nitroreductase family protein | 57, 102, 106, 153 | |
| MMP0450 | ferredoxin | 1, 70 | |
| MMP0451 | hypothetical protein MMP0451 | 1, 70 | |
| MMP0452 | hypothetical protein MMP0452 | 75, 160 | |
| MMP0453 | neutral zinc metallopeptidase | 22, 75 | |
| MMP0458 | hypothetical protein MMP0458 | 75, 160 | |
| MMP0531 | hypothetical protein MMP0531 | 106, 140 | |
| MMP0535 | hypothetical protein MMP0535 | 57, 102, 106 | |
| MMP0536 | hypothetical protein MMP0536 | 1, 28 | |
| MMP0562 | hypothetical protein MMP0562 | 49, 124 | |
| MMP0595 | hypothetical protein MMP0595 | 75, 160 | |
| MMP0598 | phosphoglycerate mutase-related | 106, 151 | |
| MMP0605 | putative RNA-processing protein | 12, 106 | |
| MMP0608 | 2-hydroxyglutaryl-CoA dehydratase subunit A-like protein | 1, 28 | |
| MMP0630 | feoB | ferrous iron transporter | 28, 76, 106, 121 |
| MMP0635 | ABC transporter ATPase | 75, 108 | |
| MMP0636 | hypothetical protein MMP0636 | 75, 160 | |
| MMP0643 | hypothetical protein MMP0643 | 49, 65 | |
| MMP0685 | N-6 adenine-specific DNA methylase | 1, 144 | |
| MMP0723 | hypothetical protein MMP0723 | 75, 160 | |
| MMP0725 | putative integral membrane protein | 49, 75, 90, 151 | |
| MMP0727 | uvrB | excinuclease ABC subunit B | 49, 142 |
| MMP0742 | hypothetical protein MMP0742 | 23, 49 | |
| MMP0808 | hypothetical protein MMP0808 | 12, 106 | |
| MMP0809 | phosphoribosylaminoimidazole carboxylase-like protein | 12, 106 | |
| MMP0876 | cofG | FO synthase subunit 1 | 1, 129 |
| MMP0902 | hypothetical protein MMP0902 | 12, 49, 55 | |
| MMP0909 | hypothetical protein MMP0909 | 75, 104 | |
| MMP0918 | asnB | glutamine-hydrolyzing asparagine synthase | 49, 115 |
| MMP0934 | hypothetical protein MMP0934 | 75, 126 | |
| MMP0958 | hypothetical protein MMP0958 | 57, 102, 106 | |
| MMP0959 | trxB | FAD-dependent pyridine nucleotide-disulfide oxidoreductase | 57, 102, 106 |
| MMP0969 | hypothetical protein MMP0969 | 106, 115 | |
| MMP1001 | hypothetical protein MMP1001 | 57, 102, 106 | |
| MMP1051 | surE | stationary phase survival protein SurE | 12, 28, 106 |
| MMP1069 | basic helix-loop-helix dimerization domain-containing protein | 106, 115 | |
| MMP1071 | hypothetical protein MMP1071 | 1, 106 | |
| MMP1072 | aminotransferase (subgroup I) aromatic aminotransferase | 1, 106 | |
| MMP1073 | ehbC | putative monovalent cation/H+ antiporter subunit G | 35, 106 |
| MMP1074 | ehbD | hypothetical protein MMP1074 | 17, 106 |
| MMP1091 | ADP-glucose pyrophosphorylase | 99, 106 | |
| MMP1140 | fdxA | ferredoxin | 1, 46 |
| MMP1141 | ATP-dependent helicase | 75, 142 | |
| MMP1162 | beta-lactamase domain-containing protein | 75, 108 | |
| MMP1185 | hydrogen uptake protein:hydrogenase maturation protease HycI | 1, 46 | |
| MMP1218 | hypothetical protein MMP1218 | 12, 46, 49 | |
| MMP1220 | glgP | alpha-glucan phosphorylase | 50, 75 |
| MMP1234 | UBA/THIF-type NAD/FAD binding protein | 33, 54, 55, 106 | |
| MMP1235 | moaE | molybdopterin biosynthesis MoaE | 49, 55, 106, 117, 150 |
| MMP1238 | bioB | biotin synthase | 1, 153 |
| MMP1240 | Sep-tRNA:Cys-tRNA synthetase | 1, 55 | |
| MMP1241 | hypothetical protein MMP1241 | 1, 55, 94, 117 | |
| MMP1282 | hypothetical protein MMP1282 | 49, 102, 106, 150 | |
| MMP1283 | hypothetical protein MMP1283 | 49, 102, 150 | |
| MMP1290 | GTP-binding protein | 49, 115 | |
| MMP1295 | glucose-6-phosphate isomerase | 43, 75 | |
| MMP1343 | hypothetical protein MMP1343 | 49, 151 | |
| MMP1345 | undecaprenyl pyrophospahte synthetase-like protein | 49, 111 | |
| MMP1346 | basic helix-loop-helix dimerization domain-containing protein | 49, 67, 142 | |
| MMP1372 | manB | phosphomannomutase | 49, 94, 152 |
| MMP1430 | cation transporter | 49, 115 | |
| MMP1431 | 2pgk | 2-phosphoglycerate kinase | 49, 51 |
| MMP1469 | ehbA | putative monovalent cation/H+ antiporter subunit E | 10, 106 |
| MMP1549 | AP endonuclease | 1, 94, 152 | |
| MMP1550 | NADP oxidoreductase, coenzyme F420-dependent | 1, 58 | |
| MMP1551 | ffh | signal recognition particle protein Srp54 | 49, 55, 83 |
| MMP1573 | bioD | dethiobiotin synthase | 28, 106 |
| MMP1598 | hypothetical protein MMP1598 | 76, 102, 106 | |
| MMP1603 | ferredoxin | 12, 49 | |
| MMP1605 | pyruvate kinase | 1, 54, 146, 166 | |
| MMP1606 | flavoprotein:DNA/pantothenate metabolism flavoprotein | 1, 13, 49 | |
| MMP1607 | hypothetical protein MMP1607 | 49, 55, 83 | |
| MMP1611 | hypothetical protein MMP1611 | 21, 106 | |
| MMP1682 | recJ | single stranded DNA-specific exonuclease | 21, 106 |
| MMP1712 | LysR family transcriptional regulator | 19, 106 | |
| Unanno_42 | None | 49, 90 | |
| Unanno_62 | None | 49, 90 |
Gene Page Help
Network Tab
If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.
Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.
Regulation Tab
Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.
If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.
You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".
For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.
Motifs Tab
Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.
Functions Tab
Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.
Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.
Module Members Tab
Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.
Help Tab
This help page. More general help can be accessed by clicking help menu in the main navigation bar.
CircVis
Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
- 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
- 2. Source gene
- 3. Target genes (other module members)
- 4. Interactions between source and target genes for a particular module
- 5. Module(s) that source gene and target genes belong to
- 6. Visualisation legend


Module member
Regulator
Motif 

Social Tab
Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.
Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.
In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.