Organism : Methanococcus maripaludis S2
| Module List :
MMP1235 moaE
molybdopterin biosynthesis MoaE
Functional Annotations (3)
| Function | System |
|---|---|
| Molybdopterin converting factor, large subunit | cog/ cog |
| Mo-molybdopterin cofactor biosynthetic process | go/ biological_process |
| Sulfur relay system | kegg/ kegg pathway |
Regulation information for MMP1235
(Mouseover regulator name to see its description)
| Regulator | Module | Operator |
|---|---|---|
| H2 | 49 | ef |
| MMP0460 | 49 | tf |
| MMP0499 MMP1065 |
49 | combiner |
| MMP0460 | 55 | tf |
| MMP0527 | 55 | tf |
| MMP0907 MMP1023 |
55 | combiner |
| MMP0907 MMP1646 |
55 | combiner |
| MMP1023 | 55 | tf |
| MMP1447 | 55 | tf |
| MMP0527 MMP1100 |
150 | combiner |
| MMP1376 | 150 | tf |
| MMP0041 MMP1023 |
106 | combiner |
| MMP0460 MMP0799 |
106 | combiner |
| MMP0568 H2 |
106 | combiner |
| MMP0799 MMP1065 |
106 | combiner |
| MMP1065 | 106 | tf |
| MMP0527 MMP1210 |
117 | combiner |
| MMP0568 | 117 | tf |
| MMP1065 | 117 | tf |
| MMP1065 MMP1210 |
117 | combiner |
Motif information (de novo identified motifs for modules)
There are 10 motifs predicted.
| Motif Id | e-value | Consensus | Motif Logo |
|---|---|---|---|
| 759 | 1.20e+00 | tagATatattGgtGa |
![]() |
| 760 | 1.90e+01 | caAgTcTGgTGg |
![]() |
| 771 | 2.40e+01 | gcgatgggg.ggAagA.taCctg |
![]() |
| 772 | 1.60e+03 | AatTGgTGAa |
![]() |
| 869 | 1.10e+03 | CGAGTAAACCGGATAGCTTAC |
![]() |
| 870 | 5.60e+03 | TGaagGGCaGtggcA |
![]() |
| 889 | 2.10e+01 | TTTcttctagaaTATcccgGgtGA |
![]() |
| 890 | 3.40e+01 | TTTTCcagatTttg |
![]() |
| 949 | 5.10e+02 | TacgGggtGtT |
![]() |
| 950 | 2.10e+03 | cttCatatt.cA.AatccccTTc |
![]() |
Functional Enrichment for MMP1235
| Function | System |
|---|---|
| Molybdopterin converting factor, large subunit | cog/ cog |
| Mo-molybdopterin cofactor biosynthetic process | go/ biological_process |
| Sulfur relay system | kegg/ kegg pathway |
Module neighborhood information for MMP1235
| Gene | Common Name | Description | Module membership |
|---|---|---|---|
| Antisense_10 | None | 2, 43, 150 | |
| Antisense_13 | None | 49, 129 | |
| Antisense_23 | None | 1, 117 | |
| Antisense_24 | None | 5, 49, 90 | |
| MMP0001 | hypothetical protein MMP0001 | 46, 106, 121, 144 | |
| MMP0002 | L-seryl-tRNA selenium transferase | 12, 46, 76, 106, 121 | |
| MMP0020 | nickel responsive regulator | 49, 123 | |
| MMP0030 | MCM family DNA replication protein | 106, 117 | |
| MMP0036 | tfe | transcription initiation factor E subunit alpha | 49, 87, 92, 129 |
| MMP0052 | putative CBS domain-containing signal transduction protein | 13, 117 | |
| MMP0063 | argB | acetylglutamate kinase | 49, 151 |
| MMP0069 | methylated-DNA--protein-cysteine methyltransferase | 23, 150 | |
| MMP0084 | hypothetical protein MMP0084 | 49, 106 | |
| MMP0085 | hypothetical protein MMP0085 | 22, 106 | |
| MMP0086 | tfx | putative transcriptional regulator | 150, 160 |
| MMP0091 | hypothetical protein MMP0091 | 51, 106 | |
| MMP0102 | pcm | protein-L-isoaspartate O-methyltransferase | 2, 43, 150 |
| MMP0120 | hypothetical protein MMP0120 | 55, 142 | |
| MMP0121 | hypothetical protein MMP0121 | 55, 57 | |
| MMP0177 | hypothetical protein MMP0177 | 83, 117, 152 | |
| MMP0190 | hypothetical protein MMP0190 | 150, 159 | |
| MMP0225 | gldA | glycerol dehydrogenase | 117, 142 |
| MMP0226 | ExsB family transcriptional regulator | 13, 117 | |
| MMP0239 | hypothetical protein MMP0239 | 1, 49, 75, 106 | |
| MMP0268 | truA | tRNA pseudouridine synthase A | 49, 51 |
| MMP0277 | TraB family protein | 49, 90 | |
| MMP0279 | mptG | beta-ribofuranosylaminobenzene 5'-phosphate synthase family protein | 49, 90 |
| MMP0289 | hypD | hydrogenase expression/formation protein HypD | 12, 117 |
| MMP0302 | hypothetical protein MMP0302 | 49, 90 | |
| MMP0307 | hypothetical protein MMP0307 | 33, 49, 153 | |
| MMP0420 | CBS domain-containing protein | 13, 106 | |
| MMP0425 | hypothetical protein MMP0425 | 57, 102, 106 | |
| MMP0426 | nitroreductase family protein | 57, 102, 106, 153 | |
| MMP0439 | pyrD | dihydroorotate dehydrogenase 1B | 117, 119 |
| MMP0482 | hypothetical protein MMP0482 | 54, 55 | |
| MMP0483 | hypothetical protein MMP0483 | 54, 55 | |
| MMP0528 | hypothetical protein MMP0528 | 23, 150 | |
| MMP0531 | hypothetical protein MMP0531 | 106, 140 | |
| MMP0535 | hypothetical protein MMP0535 | 57, 102, 106 | |
| MMP0543 | hypothetical protein MMP0543 | 55, 159 | |
| MMP0544 | MoaA/nifB/pqqE family protein | 55, 142 | |
| MMP0545 | putative molybdopterin biosynthesis protein MoeA/LysR substrate binding-domain-containing protein | 55, 142 | |
| MMP0562 | hypothetical protein MMP0562 | 49, 124 | |
| MMP0598 | phosphoglycerate mutase-related | 106, 151 | |
| MMP0605 | putative RNA-processing protein | 12, 106 | |
| MMP0630 | feoB | ferrous iron transporter | 28, 76, 106, 121 |
| MMP0638 | hypothetical protein MMP0638 | 54, 55 | |
| MMP0643 | hypothetical protein MMP0643 | 49, 65 | |
| MMP0725 | putative integral membrane protein | 49, 75, 90, 151 | |
| MMP0727 | uvrB | excinuclease ABC subunit B | 49, 142 |
| MMP0742 | hypothetical protein MMP0742 | 23, 49 | |
| MMP0788 | hypothetical protein MMP0788 | 58, 117 | |
| MMP0808 | hypothetical protein MMP0808 | 12, 106 | |
| MMP0809 | phosphoribosylaminoimidazole carboxylase-like protein | 12, 106 | |
| MMP0849 | L-lysine/ homoserine-homoserine lactone exporter family protein | 95, 117 | |
| MMP0902 | hypothetical protein MMP0902 | 12, 49, 55 | |
| MMP0903 | hypothetical protein MMP0903 | 33, 54, 55 | |
| MMP0918 | asnB | glutamine-hydrolyzing asparagine synthase | 49, 115 |
| MMP0958 | hypothetical protein MMP0958 | 57, 102, 106 | |
| MMP0959 | trxB | FAD-dependent pyridine nucleotide-disulfide oxidoreductase | 57, 102, 106 |
| MMP0969 | hypothetical protein MMP0969 | 106, 115 | |
| MMP0992 | hypothetical protein MMP0992 | 55, 117 | |
| MMP1001 | hypothetical protein MMP1001 | 57, 102, 106 | |
| MMP1019 | PEGA domain-containing protein | 23, 150 | |
| MMP1051 | surE | stationary phase survival protein SurE | 12, 28, 106 |
| MMP1065 | BadM/Rrf2 family transcriptional regulator | 55, 152 | |
| MMP1069 | basic helix-loop-helix dimerization domain-containing protein | 106, 115 | |
| MMP1071 | hypothetical protein MMP1071 | 1, 106 | |
| MMP1072 | aminotransferase (subgroup I) aromatic aminotransferase | 1, 106 | |
| MMP1073 | ehbC | putative monovalent cation/H+ antiporter subunit G | 35, 106 |
| MMP1074 | ehbD | hypothetical protein MMP1074 | 17, 106 |
| MMP1088 | group 1 glycosyl transferase | 31, 117 | |
| MMP1091 | ADP-glucose pyrophosphorylase | 99, 106 | |
| MMP1118 | hypothetical protein MMP1118 | 83, 117 | |
| MMP1218 | hypothetical protein MMP1218 | 12, 46, 49 | |
| MMP1234 | UBA/THIF-type NAD/FAD binding protein | 33, 54, 55, 106 | |
| MMP1235 | moaE | molybdopterin biosynthesis MoaE | 49, 55, 106, 117, 150 |
| MMP1236 | hypothetical protein MMP1236 | 22, 55, 117, 142, 152 | |
| MMP1237 | hypothetical protein MMP1237 | 50, 150 | |
| MMP1240 | Sep-tRNA:Cys-tRNA synthetase | 1, 55 | |
| MMP1241 | hypothetical protein MMP1241 | 1, 55, 94, 117 | |
| MMP1256 | hypothetical protein MMP1256 | 150, 159 | |
| MMP1282 | hypothetical protein MMP1282 | 49, 102, 106, 150 | |
| MMP1283 | hypothetical protein MMP1283 | 49, 102, 150 | |
| MMP1290 | GTP-binding protein | 49, 115 | |
| MMP1294 | glgA | starch synthase | 43, 150, 166 |
| MMP1330 | hydrogenase assembly chaperone hypC/hupF | 100, 117 | |
| MMP1343 | hypothetical protein MMP1343 | 49, 151 | |
| MMP1345 | undecaprenyl pyrophospahte synthetase-like protein | 49, 111 | |
| MMP1346 | basic helix-loop-helix dimerization domain-containing protein | 49, 67, 142 | |
| MMP1372 | manB | phosphomannomutase | 49, 94, 152 |
| MMP1387 | hypothetical protein MMP1387 | 33, 73, 150 | |
| MMP1428 | hypothetical protein MMP1428 | 55, 83 | |
| MMP1430 | cation transporter | 49, 115 | |
| MMP1431 | 2pgk | 2-phosphoglycerate kinase | 49, 51 |
| MMP1447 | Cro repressor family protein | 22, 117 | |
| MMP1452 | ehaE | hypothetical protein MMP1452 | 22, 117 |
| MMP1453 | ehaF | hypothetical protein MMP1453 | 22, 117 |
| MMP1454 | ehaG | hypothetical protein MMP1454 | 66, 117, 133 |
| MMP1456 | ehaI | hypothetical protein MMP1456 | 66, 117, 133 |
| MMP1459 | ehaL | hypothetical protein MMP1459 | 66, 117, 133 |
| MMP1461 | ehaN | energy conserving hydrogenase A small subunit | 117, 133 |
| MMP1469 | ehbA | putative monovalent cation/H+ antiporter subunit E | 10, 106 |
| MMP1487 | gapN | aldehyde dehydrogenase | 55, 152 |
| MMP1551 | ffh | signal recognition particle protein Srp54 | 49, 55, 83 |
| MMP1552 | 3-octaprenyl-4-hydroxybenzoate carboxy-lyase | 54, 150 | |
| MMP1573 | bioD | dethiobiotin synthase | 28, 106 |
| MMP1598 | hypothetical protein MMP1598 | 76, 102, 106 | |
| MMP1603 | ferredoxin | 12, 49 | |
| MMP1606 | flavoprotein:DNA/pantothenate metabolism flavoprotein | 1, 13, 49 | |
| MMP1607 | hypothetical protein MMP1607 | 49, 55, 83 | |
| MMP1608 | hypothetical protein MMP1608 | 150, 160 | |
| MMP1611 | hypothetical protein MMP1611 | 21, 106 | |
| MMP1619 | molybdenum cofactor biosynthesis protein MoeA | 117, 152 | |
| MMP1653 | hypothetical protein MMP1653 | 150, 166 | |
| MMP1662 | cbiF | precorrin-4 C11-methyltransferase | 66, 117 |
| MMP1665 | HEAT domain-containing protein | 66, 117 | |
| MMP1679 | hypothetical protein MMP1679 | 117, 151 | |
| MMP1682 | recJ | single stranded DNA-specific exonuclease | 21, 106 |
| MMP1712 | LysR family transcriptional regulator | 19, 106 | |
| Unanno_42 | None | 49, 90 | |
| Unanno_49 | None | 95, 117 | |
| Unanno_62 | None | 49, 90 |
Gene Page Help
Network Tab
If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.
Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.
Regulation Tab
Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.
If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.
You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".
For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.
Motifs Tab
Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.
Functions Tab
Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.
Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.
Module Members Tab
Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.
Help Tab
This help page. More general help can be accessed by clicking help menu in the main navigation bar.
CircVis
Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
- 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
- 2. Source gene
- 3. Target genes (other module members)
- 4. Interactions between source and target genes for a particular module
- 5. Module(s) that source gene and target genes belong to
- 6. Visualisation legend


Module member
Regulator
Motif 

Social Tab
Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.
Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.
In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.