Organism : Halobacterium salinarum NRC-1 | Module List :
VNG0462C

hypothetical protein VNG0462C

CircVis
Functional Annotations (4)
Function System
Transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG0462C
(Mouseover regulator name to see its description)

VNG0462C is regulated by 23 influences and regulates 14 modules.
Regulators for VNG0462C (23)
Regulator Module Operator
VNG0835G
VNG6288C
57 combiner
VNG5176C
VNG6288C
57 combiner
VNG6143H 57 tf
VNG6389G 57 tf
VNG1510C
VNG6288C
68 combiner
VNG6143H 68 tf
VNG6288C 68 tf
VNG0389C
VNG1548C
151 combiner
VNG1510C
VNG6288C
151 combiner
VNG1616C
VNG0826C
151 combiner
VNG1886C 151 tf
VNG6389G 151 tf
VNG1237C 162 tf
VNG1510C 162 tf
VNG1786H 162 tf
VNG2112C 162 tf
VNG2112C 42 tf
VNG6143H 42 tf
VNG6389G 42 tf
VNG1179C 246 tf
VNG1786H 246 tf
VNG2112C 246 tf
VNG5163G 246 tf
Regulated by VNG0462C (14)
Module Residual Genes
9 0.49 32
38 0.27 22
83 0.28 7
101 0.33 2
111 0.24 8
115 0.27 9
118 0.41 30
129 0.31 10
130 0.32 9
155 0.25 3
190 0.41 30
202 0.27 2
233 0.30 7
239 0.33 8
Motif information (de novo identified motifs for modules)

There are 12 motifs predicted.

Motif Table (12)
Motif Id e-value Consensus Motif Logo
1061 3.40e+00 acgatCttgtcgt.g
Loader icon
1062 3.80e+04 ACTGACAGtaTATGT
Loader icon
1089 8.20e+01 Ggatc.cgaacgtcGttttCG
Loader icon
1090 1.00e+04 AaATCAaCAacACAGATAcacTA
Loader icon
1111 5.00e-06 AAaagAGTtacgaA.cacgtc
Loader icon
1112 6.60e-02 Agca..aaTc.tgT.TtCgtAGCt
Loader icon
1267 6.30e-01 AcGcCgaCgaC
Loader icon
1268 4.20e+01 AAAGACACATAAATAAGCGT
Loader icon
1285 1.30e+03 ACcTCGT
Loader icon
1286 2.40e+03 ACtaC.cCaCtA.AATccaT
Loader icon
1427 1.00e+03 cGaCgcgCtCG
Loader icon
1428 7.30e+03 GaACG.TgTTT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG0462C

VNG0462C is enriched for 4 functions in 3 categories.
Enrichment Table (4)
Function System
Transcriptional regulators cog/ cog
sequence-specific DNA binding transcription factor activity go/ molecular_function
intracellular go/ cellular_component
regulation of transcription, DNA-dependent go/ biological_process
Module neighborhood information for VNG0462C

VNG0462C has total of 82 gene neighbors in modules 42, 57, 68, 151, 162, 246
Gene neighbors (82)
Gene Common Name Description Module membership
VNG0138H hypothetical protein VNG0138H 57, 209, 298
VNG0188H hypothetical protein VNG0188H 246, 265
VNG0284C hypothetical protein VNG0284C 118, 151
VNG0298H hypothetical protein VNG0298H 57, 269, 298
VNG0301C nicotinamide-nucleotide adenylyltransferase 57, 298
VNG0314G aroD 3-dehydroquinate dehydratase 118, 151
VNG0316C hypothetical protein VNG0316C 42, 68
VNG0396C hypothetical protein VNG0396C 26, 57, 243
VNG0430H hypothetical protein VNG0430H 42, 68, 151
VNG0462C hypothetical protein VNG0462C 42, 57, 68, 151, 162, 246
VNG0463C hypothetical protein VNG0463C 14, 162, 246, 249
VNG0486G hat1 putative acetyltransferase 68
VNG0499G cna proliferating-cell nucleolar antigen 57, 86, 139, 209, 298
VNG0761G dip3 competence-damage protein CinA-like 44, 151, 214
VNG0763G ybjG membrane protein 57, 243
VNG0799C hypothetical protein VNG0799C 118, 151
VNG0819C hypothetical protein VNG0819C 42
VNG0836H hypothetical protein VNG0836H 42, 68
VNG0840H hypothetical protein VNG0840H 166, 246
VNG0858C hypothetical protein VNG0858C 68
VNG0870G gatC hypothetical protein VNG0870G 42, 68
VNG0907H hypothetical protein VNG0907H 126, 162, 246
VNG0908G putP hypothetical protein VNG0908G 118, 162, 246
VNG0909H hypothetical protein VNG0909H 162, 246
VNG0928G mak MAPK-activated protein kinase 151, 257
VNG0938G gufA GufA protein 57, 86, 139, 209, 298
VNG0988H hypothetical protein VNG0988H 42, 68, 107, 203, 207, 210
VNG1174G nop56/58 nucleolar protein-like protein 57, 284
VNG1266G ogg 8-oxoguanine DNA glycosylase 154, 162
VNG1270H hypothetical protein VNG1270H 18, 30, 37, 42
VNG1311G alkA 3-methyladenine DNA glycosylase 246, 285
VNG1317H hypothetical protein VNG1317H 130, 246
VNG1362H hypothetical protein VNG1362H 68
VNG1405C hypothetical protein VNG1405C 11, 73, 151, 257, 273
VNG1431C hypothetical protein VNG1431C 151
VNG1440H hypothetical protein VNG1440H 151
VNG1444G hisD histidinol dehydrogenase 151, 176
VNG1450G yfkN 2',3'-cyclic-nucleotide 2'-phosphodiesterase 46, 151, 173
VNG1455H hypothetical protein VNG1455H 26, 31, 57, 86
VNG1503C hypothetical protein VNG1503C 246, 300
VNG1505G htr10 Htr10 68, 214
VNG1784C DNA primase 28, 42, 68, 83, 234
VNG1785G panF hypothetical protein VNG1785G 57, 86, 232, 243, 298
VNG1811G eye succinoglycan biosynthesis 42, 68, 179, 286
VNG1815G carA carbamoyl phosphate synthase small subunit 68, 86, 209, 257, 294, 298
VNG1816G trh3 transcription regulator 68, 86, 139, 209, 238, 257, 298
VNG1818G idi Idi 68, 86, 209, 214, 234, 257
VNG1848H hypothetical protein VNG1848H 151
VNG1859G deoC hypothetical protein VNG1859G 42, 68
VNG1872C hypothetical protein VNG1872C 42, 68, 186
VNG1886C hypothetical protein VNG1886C 42, 68
VNG1891H hypothetical protein VNG1891H 14, 42, 68, 135
VNG1893G trp2 ABC transport protein 14, 42
VNG1894C hypothetical protein VNG1894C 14, 42
VNG1921H hypothetical protein VNG1921H 68
VNG1946G purU formyltetrahydrofolate deformylase 68
VNG1952H hypothetical protein VNG1952H 18, 28, 30, 42, 68, 80, 91, 108, 121, 135
VNG1953C hypothetical protein VNG1953C 13, 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1956H hypothetical protein VNG1956H 18, 30, 34, 42, 80, 91, 108, 115, 121
VNG1980C hypothetical protein VNG1980C 68, 135
VNG2080C hypothetical protein VNG2080C 116, 162
VNG2156C hypothetical protein VNG2156C 57, 106, 209, 243, 298
VNG2270G mutS3 hypothetical protein VNG2270G 57, 86, 298
VNG2298H hypothetical protein VNG2298H 42, 68, 152
VNG2335H hypothetical protein VNG2335H 57, 86, 106, 139, 209, 257, 298
VNG2501C hypothetical protein VNG2501C 68, 214, 234
VNG5150H None 38, 42
VNG5175H None 42, 68, 234
VNG6135C hypothetical protein VNG6135C 162
VNG6142C hypothetical protein VNG6142C 42, 68, 295
VNG6144G trsE transfer complex protein 4, 5, 42, 68, 295
VNG6148H hypothetical protein VNG6148H 42, 68
VNG6158H hypothetical protein VNG6158H 42, 68
VNG6168H hypothetical protein VNG6168H 38, 42
VNG6187G orc3 orc / cell division control protein 6 42, 68
VNG6193H hypothetical protein VNG6193H 17, 32, 34, 38, 41, 42, 44, 80
VNG6203H hypothetical protein VNG6203H 42
VNG6232G gvpJ2 GvpJ protein, cluster B 4, 5, 8, 28, 31, 42, 141, 148, 182, 188
VNG6235G gvpH2 GvpH protein, cluster B 31, 42, 141, 188
VNG6242G gvpC2 GvpC protein, cluster B 42, 185
VNG7047 hypothetical protein VNG7047 57, 86, 209, 216, 298
VNG7099 hypothetical protein VNG7099 57, 209
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG0462C
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend