Organism : Halobacterium salinarum NRC-1 | Module List :
VNG0940Gm ACS3

Acetyl-CoA synthetase

CircVis
Functional Annotations (3)
Function System
Acyl-CoA synthetase (NDP forming) cog/ cog
catalytic activity go/ molecular_function
metabolic process go/ biological_process
GeneModule member RegulatorRegulator MotifMotif

Cytoscape Web
Regulation information for VNG0940Gm
(Mouseover regulator name to see its description)

VNG0940Gm is regulated by 33 influences and regulates 0 modules.
Regulators for VNG0940Gm ACS3 (33)
Regulator Module Operator
VNG0194H 49 tf
VNG0254G 49 tf
VNG0293H
VNG0703H
49 combiner
VNG0734G
VNG2641H
49 combiner
VNG1029C 49 tf
VNG1123G 49 tf
VNG1464G
VNG1029C
49 combiner
VNG1496G
VNG0320H
49 combiner
VNG2163H 49 tf
VNG2243G 49 tf
VNG0194H 29 tf
VNG0258H 29 tf
VNG2661G
VNG1029C
29 combiner
VNG0101G
VNG2163H
24 combiner
VNG0194H 24 tf
VNG2661G
VNG1029C
24 combiner
VNG0194H 25 tf
VNG0458G
VNG2641H
25 combiner
VNG1899G
VNG2243G
25 combiner
VNG1899G
VNG2641H
25 combiner
VNG2243G
VNG0293H
25 combiner
VNG2441G
VNG2641H
25 combiner
VNG0254G 7 tf
VNG0536G
VNG0258H
7 combiner
VNG1836G
VNG1899G
7 combiner
VNG1899G
VNG0258H
7 combiner
VNG5028G
VNG0258H
7 combiner
VNG0258H 19 tf
VNG0458G
VNG0258H
19 combiner
VNG0703H 19 tf
VNG1029C 19 tf
VNG1617H 19 tf
VNG2661G
VNG1029C
19 combiner

Warning: VNG0940Gm Does not regulate any modules!

Motif information (de novo identified motifs for modules)

There are 12 motifs predicted.

Motif Table (12)
Motif Id e-value Consensus Motif Logo
993 1.30e+01 ttggtGataaTcgat
Loader icon
994 7.70e+02 GAtAat..tCaactGTt.gtaA
Loader icon
1017 1.70e+01 AATtaacct.TatcA
Loader icon
1018 1.60e+03 acgtgGTTT.A
Loader icon
1025 3.90e-02 tttaaaacgtTtgc
Loader icon
1026 8.10e+02 cACgaAgA.cc
Loader icon
1027 8.00e+00 TACATGGTACAACTAGATAATTAA
Loader icon
1028 5.20e+02 GgGTtcCcGtcgGaGgCaAAaAC
Loader icon
1035 1.80e+00 Cag.AaTtaacgTttataa
Loader icon
1036 3.80e+02 tTTAtaacCgt
Loader icon
1075 7.90e-01 aGAaAAttgtTga
Loader icon
1076 7.90e+00 gaAtcgaacggaAagcaTtaAgT
Loader icon
Motif Help

Transcription factor binding motifs help to elucidate regulatory mechanism. cMonkey integrates powerful de novo motif detection to identify conditionally co-regulated sets of genes. De novo predicted motifs for each module are listed in the module page as motif logo images along with associated prediction statistics (e-values). The main module page also shows the location of these motifs within the upstream sequences of the module member genes.

Motifs of interest can be broadcasted to RegPredict (currently only available for Desulfovibrio vulgaris Hildenborough) in order to compare conservation in similar species. This integrated motif prediction and comparative analysis provides an additional checkpoint for regulatory motif prediction confidence.

Motif e-value: cMonkey tries to identify two motifs per modules in the upstream sequences of the module member genes. Motif e-value is an indicative of the motif co-occurences between the members of the module.Smaller e-values are indicative of significant sequence motifs. Our experience showed that e-values smaller than 10 are generally indicative of significant motifs.

Functional Enrichment for VNG0940Gm

VNG0940Gm is enriched for 3 functions in 3 categories.
Enrichment Table (3)
Function System
Acyl-CoA synthetase (NDP forming) cog/ cog
catalytic activity go/ molecular_function
metabolic process go/ biological_process
Module neighborhood information for VNG0940Gm

VNG0940Gm has total of 98 gene neighbors in modules 7, 19, 24, 25, 29, 49
Gene neighbors (98)
Gene Common Name Description Module membership
VNG0162G alkK AlkK 3, 12, 49, 113, 123
VNG0192G ftsZ2 cell division protein FtsZ 2, 3, 7, 12, 16, 49, 50, 71, 78, 79, 123
VNG0194H hypothetical protein VNG0194H 3, 7, 12, 16, 50, 79, 123
VNG0207H hypothetical protein VNG0207H 2, 3, 7, 12, 16, 49, 67, 71, 78, 79, 113, 123
VNG0208H hypothetical protein VNG0208H 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123
VNG0209H hypothetical protein VNG0209H 2, 3, 7, 12, 16, 24, 29, 49, 67, 71, 78, 79, 113, 123
VNG0227H hypothetical protein VNG0227H 25, 55
VNG0254G tfbG transcription initiation factor IIB 3, 12, 25, 50, 55, 113
VNG0258H hypothetical protein VNG0258H 3, 12, 16, 49, 79, 100, 109, 150
VNG0259G ipp inorganic pyrophosphatase 7, 12, 16, 79, 109
VNG0261H hypothetical protein VNG0261H 7, 12, 16, 25, 49, 50, 55, 79, 109, 113
VNG0262C hypothetical protein VNG0262C 12, 25, 49, 50, 55, 79, 109, 113
VNG0321G ids Ids 7, 25, 50, 55
VNG0524G yurY ABC transporter ATP-binding protein 2, 3, 7, 12, 16, 71, 113, 225
VNG0525C hypothetical protein VNG0525C 7, 12, 71, 78, 113, 225
VNG0527C hypothetical protein VNG0527C 2, 3, 7, 12, 16, 71, 78, 79, 113, 123, 225
VNG0533H hypothetical protein VNG0533H 25, 50
VNG0579H hypothetical protein VNG0579H 49, 79, 123, 187
VNG0584H hypothetical protein VNG0584H 2, 16, 24
VNG0585H hypothetical protein VNG0585H 2, 16, 24
VNG0635G nolB NADH dehydrogenase/oxidoreductase-like protein 2, 16, 19, 24, 29, 199
VNG0636G ndhG1 NADH dehydrogenase/oxidoreductase 19, 24, 29
VNG0637G ndhG5 NADH dehydrogenase/oxidoreductase 2, 16, 19, 24, 29
VNG0639G ndhG4 NADH dehydrogenase/oxidoreductase 19, 24, 29, 199
VNG0640G nolD NADH dehydrogenase/oxidoreductase-like protein 2, 3, 16, 19, 24, 29, 45, 123
VNG0641C NADH dehydrogenase subunit J 19, 24, 29, 45, 199
VNG0642C hypothetical protein VNG0642C 2, 24, 29, 45
VNG0643G nolC NADH dehydrogenase/oxidoreductase-like protein 19, 29, 199
VNG0646G nuoL F420H2:quinone oxidoreductase subunit L 29, 45
VNG0715G thiC thiamine biosynthesis protein ThiC 19
VNG0796G cgs cystathionine gamma synthase/lyase 7, 50
VNG0801C hypothetical protein VNG0801C 12, 49, 71, 79, 113, 187
VNG0880G psmA proteasome subunit alpha 12, 49, 71, 79, 109
VNG0932C hypothetical protein VNG0932C 25, 50, 61
VNG0940Gm ACS3 Acetyl-CoA synthetase 7, 19, 24, 25, 29, 49
VNG0946G minD1 cell division inhibitor 7
VNG0949G gspE3 type II secretion system protein 7
VNG0954C hypothetical protein VNG0954C 7, 278, 283
VNG0955G fapE flagella-like protein E 7, 16, 25, 50, 100, 291
VNG0960G flaB1 flagellin B1 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123
VNG0961G flaB2 flagellin B2 2, 3, 7, 12, 16, 49, 78, 79, 100, 113, 123, 291
VNG0962G flaB3 flagellin B3 2, 3, 7, 12, 16, 49, 78, 100, 113, 123
VNG0964C hypothetical protein VNG0964C 12, 24, 49, 100, 109
VNG0974G cheY hypothetical protein VNG0974G 7, 55, 61, 184
VNG0976G cheW1 chemotaxis protein 7, 55
VNG1002H hypothetical protein VNG1002H 49, 242
VNG1125G korB KorB 7, 12, 24, 29
VNG1128G korA KorA 3, 7, 12, 24, 29, 49, 71, 78, 113
VNG1261H hypothetical protein VNG1261H 49, 113
VNG1264C hypothetical protein VNG1264C 9, 25, 55, 84
VNG1273G moaC putative molybdenum cofactor biosynthesis protein MoaC 25, 81
VNG1292H hypothetical protein VNG1292H 24, 33
VNG1310G sdhC hypothetical protein VNG1310G 2, 24, 236
VNG1326H hypothetical protein VNG1326H 25, 50, 55
VNG1412H hypothetical protein VNG1412H 3, 12, 49, 71, 79, 113
VNG1446H hypothetical protein VNG1446H 25, 55
VNG1663C hypothetical protein VNG1663C 25, 50
VNG1664H hypothetical protein VNG1664H 25, 50
VNG1768G eif5a translation initiation factor IF-5A 23, 24, 40, 59
VNG1793C pyridoxal biosynthesis lyase PdxS 19, 90
VNG1836G cspD2 cold shock protein 3, 12, 49, 71, 79
VNG1898C hypothetical protein VNG1898C 25, 50, 55
VNG1933G ftsZ3 cell division protein 7, 25, 61, 227
VNG2008H hypothetical protein VNG2008H 9, 49, 79, 113, 170, 187
VNG2081H hypothetical protein VNG2081H 49, 50, 123, 175, 187
VNG2122G ilvE2 branched-chain amino acid aminotransferase 7, 19, 29, 49, 71, 75, 78
VNG2139G atpA V-type ATP synthase subunit A 23, 24, 33, 39, 45, 67, 114, 124, 227
VNG2142G atpE V-type ATP synthase subunit E 19, 24, 45, 67, 114, 227
VNG2143G atpK H+-transporting ATP synthase subunit K 2, 19, 23, 24, 45, 67, 75, 114, 124, 227
VNG2144G atpI H+-transporting ATP synthase subunit I 19, 23, 24, 45, 67, 75, 124, 227
VNG2146H hypothetical protein VNG2146H 2, 16, 19, 24, 45, 67, 124, 227
VNG2195G coxB2 cytochrome c oxidase subunit II 25, 50
VNG2196G hcpB halocyanin-like protein 25, 50
VNG2226G cctA thermosome subunit alpha 3, 7, 12, 29, 49, 50, 52, 78, 113
VNG2243G tbpE transcription factor 19, 24, 29, 128
VNG2244H hypothetical protein VNG2244H 24, 29
VNG2251G achY S-adenosyl-L-homocysteine hydrolase 24, 29, 49, 71, 79, 113
VNG2259C phosphoenolpyruvate carboxylase 25, 50
VNG2310H hypothetical protein VNG2310H 25, 229
VNG2311H hypothetical protein VNG2311H 25, 229
VNG2337C hypothetical protein VNG2337C 16, 29, 49, 113
VNG2432C hypothetical protein VNG2432C 25, 50
VNG2443G dpsA starvation induced DNA-binding protein 3, 12, 49, 71, 79, 113, 123, 187
VNG2499G gcdH glutaryl-CoA dehydrogenase 7, 24, 25, 50, 61, 78
VNG2508C hypothetical protein VNG2508C 25, 50, 55
VNG2539H hypothetical protein VNG2539H 7, 29, 78
VNG2543C hypothetical protein VNG2543C 3, 12, 49, 71, 78, 113, 156
VNG2574G can aconitate hydratase 23, 29
VNG2603H hypothetical protein VNG2603H 25, 61
VNG2604Gm THI1 ribulose-1,5-biphosphate synthetase 25, 61
VNG2606G thiD hypothetical protein VNG2606G 25, 61
VNG2644C hypothetical protein VNG2644C 25, 50
VNG2648G rps10p 30S ribosomal protein S10P 2, 3, 16, 23, 24, 29, 40, 110
VNG2649G eef1a elongation factor 1-alpha 2, 3, 16, 24, 29, 40, 79, 110
VNG6201G hsp5 heat shock protease protein 3, 49, 71, 79, 98, 100, 113, 187, 240
VNG6294G perA peroxidase / catalase 23, 24, 29, 52
VNG6312G argS arginine-tRNA synthetase 24, 29
VNG7101 hypothetical protein VNG7101 49, 71, 113
Gene Page Help

Network Tab

If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.

Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.

Regulation Tab

Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.

If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.

You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".

For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.

Motifs Tab

Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.

Functions Tab

Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.

Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.

Module Members Tab

Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.

Help Tab

This help page. More general help can be accessed by clicking help menu in the main navigation bar.

Social Tab

Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.

Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.

In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend
Comments for VNG0940Gm
Please add your comments for this gene by using the form below. Your comments will be publicly available.

comments powered by Disqus

Gene Help

Overview

Gene landing pages present genomic, functional, and regulatory information for individual genes. A circular visualization displays connections between the selected gene and genes in the same modules, with as edges drawn between the respective coordinates of the whole genome.

The gene page also lists functional ontology assignments, module membership, and motifs associated with these modules. Genes in the network inherit regulatory influences from the modules to which they belong. Therefore, the regulatory information for each gene is a collection of all regulatory influences on these modules. These are listed as a table that includes influence name, type, and target module. If the gene is a transcription factor, its target modules are also displayed in a table that provides residual values and number of genes.

CircVis

Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
  • 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
  • 2. Source gene
  • 3. Target genes (other module members)
  • 4. Interactions between source and target genes for a particular module
  • 5. Module(s) that source gene and target genes belong to
  • 6. Visualisation legend