Organism : Bacillus subtilis
| Module List :
BSU07600 yflP
hypothetical protein (RefSeq)
Functional Annotations (2)
| Function | System |
|---|---|
| Uncharacterized protein conserved in bacteria | cog/ cog |
| outer membrane-bounded periplasmic space | go/ cellular_component |
Module member 
Regulator 
Motif
Regulation information for BSU07600
(Mouseover regulator name to see its description)
| Regulator | Module | Operator |
|---|---|---|
| BSU02070 | 156 | tf |
| BSU06580 | 156 | tf |
| BSU06960 | 156 | tf |
| BSU07590 | 156 | tf |
| BSU09830 | 156 | tf |
| BSU16810 | 156 | tf |
| BSU26320 | 156 | tf |
| BSU27320 | 156 | tf |
| BSU28410 | 156 | tf |
| BSU33950 | 156 | tf |
| BSU06960 | 152 | tf |
| BSU07010 | 152 | tf |
| BSU07590 | 152 | tf |
| BSU08370 | 152 | tf |
| BSU26870 | 152 | tf |
| BSU28410 | 152 | tf |
| BSU29690 | 152 | tf |
Motif information (de novo identified motifs for modules)
There are 4 motifs predicted.
| Motif Id | e-value | Consensus | Motif Logo |
|---|---|---|---|
| 5254 | 3.00e+01 | cGttTTTaATTgTATgggAAAaaG |
 |
| 5255 | 1.10e+00 | caaaaaAAaGAtTG |
|
| 5260 | 6.30e-08 | CcgctttTcC.ttcaccTtTc |
|
| 5261 | 7.60e+01 | CAGCTGCCACCAAGCCAGATTCCC |
|
Functional Enrichment for BSU07600
| Function | System |
|---|---|
| Uncharacterized protein conserved in bacteria | cog/ cog |
| outer membrane-bounded periplasmic space | go/ cellular_component |
Module neighborhood information for BSU07600
| Gene | Common Name | Description | Module membership |
|---|---|---|---|
| BSU03110 | ycgH | putative amino acid transporter (RefSeq) | 96, 156 |
| BSU03120 | ycgI | putative methyltransferase (RefSeq) | 156, 180 |
| BSU03680 | yclG | putative uronase (RefSeq) | 129, 156 |
| BSU06920 | yesJ | putative acetyltransferase (RefSeq) | 33, 156 |
| BSU06930 | yesK | putative permease (RefSeq) | 33, 156 |
| BSU06960 | yesN | two-component response regulator [YesM] (RefSeq) | 156, 250 |
| BSU07270 | yfnH | putative sugar-phosphate cytidylyltransferase (RefSeq) | 156, 277 |
| BSU07580 | citS | two-component sensor histidine kinase (RefSeq) | 152, 156 |
| BSU07590 | citT | two-component response regulator (RefSeq) | 152, 156 |
| BSU07600 | yflP | hypothetical protein (RefSeq) | 152, 156 |
| BSU08370 | yfiR | transcriptional regulator (TetR/AcrR family) (RefSeq) | 114, 152 |
| BSU08380 | yfiS | putative efflux transporter (RefSeq) | 152, 318 |
| BSU08390 | yfiT | metal-dependent hydrolase (RefSeq) | 145, 152 |
| BSU10980 | yitG | putative efflux transporter (RefSeq) | 152, 326 |
| BSU12300 | uxaC | glucuronate isomerase (RefSeq) | 152, 180 |
| BSU12310 | exuM | putative Na+:altronate/mannonate symporter (RefSeq) | 152, 180 |
| BSU13710 | ykvI | putative transporter (RefSeq) | 156, 286 |
| BSU15650 | yloB | P-type calcium transport ATPase (RefSeq) | 156, 286 |
| BSU18270 | ynzE | hypothetical protein (RefSeq) | 156, 405 |
| BSU22090 | kdgT | 2-keto-3-deoxygluconate permease (RefSeq) | 152, 168 |
| BSU22100 | kdgA | 2-keto-3-deoxygluconate-6-phosphate aldolase (RefSeq) | 152, 168 |
| BSU22110 | kdgK | 2-keto-3-deoxygluconate kinase (RefSeq) | 152, 168 |
| BSU26860 | yraO | putative citrate transporter (RefSeq) | 152, 168 |
| BSU26870 | yraN | putative transcriptional regulator (LysR family) (RefSeq) | 152, 168 |
| BSU28380 | gerM | germination (cortex hydrolysis) and sporulation (stage II, multiple polar septa) lytic enzyme (RefSeq) | 156, 396 |
| BSU28720 | abfA | alpha-L-arabinofuranosidase (RefSeq) | 152, 250 |
| BSU28770 | araL | putative phosphatase (RefSeq) | 152, 250 |
| BSU28790 | araB | ribulokinase (RefSeq) | 152, 250 |
| BSU28800 | araA | L-arabinose isomerase (RefSeq) | 152, 250 |
| BSU31220 | yuxG | short chain dehydrogenase (RefSeq) | 156, 330 |
| BSU34120 | ganB | secreted arabinogalactan oligomer endo-hydrolase (RefSeq) | 152, 156 |
| BSU34130 | ganA | arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase) (RefSeq) | 10, 152 |
| BSU34140 | ganQ | arabinogalactan oligomer permease (RefSeq) | 152, 156 |
| BSU34150 | ganP | arabinogalactan oligomer permease (RefSeq) | 152, 156 |
| BSU34160 | cycB | cyclodextrin-binding lipoprotein (RefSeq) | 152, 156 |
| BSU38990 | scoA | succinyl CoA:3-oxoacid CoA-transferase (subunit A) (RefSeq) | 156, 180 |
| BSU39000 | yxjC | putative permease (RefSeq) | 55, 156 |
| BSU39860 | aldX | putative aldehyde dehydrogenase (RefSeq) | 156, 318 |
| BSU40430 | yycE | hypothetical protein (RefSeq) | 156, 231 |
| BSU40940 | yyaD | putative integral membrane protein; putative transporter (RefSeq) | 156, 406 |
Gene Page Help
Network Tab
If the gene is associated with a module(s), its connection to given modules along with other members of that module are shown as network by using CytoscapeWeb. In this view, each green colored circular nodes represent module member genes, purple colored diamonds represent module motifs and red triangles represent regulators. Each node is connected to module (Bicluster) via edges. This representation provides quick overview of all genes, regulators and motifs for modules. It also allows one to see shared genes/motifs/regulators among diferent modules.
Network representation is interactive. You can zoom in/out and move nodes/edges around. Clicking on a node will open up a window to give more details. For genes, Locus tag, organism, genomic coordinates, NCBI gene ID, whether it is transcription factor or not and any associated functional information will be shown. For regulators, number of modules are shown in addition to gene details. For motifs, e-value, consensus sequence and sequence logo will be shown. For modules, expression profile plot, motif information, functional associations and motif locations for each member of the module will be shown.
You can pin information boxes by using button in the box title and open up additional ones on the same screen for comparative analysis.
Regulation Tab
Regulation tab for each gene includes regulatory influences such as environmental factors or transcription factors or their combinations identified by regulatory network inference algorithms.
If the gene is a member of a module, regulators influencing that module are also considered to regulate the gene. Regulators table list total number of regulatory influences, regulators, modules and type of the influence.
You can see description of the regulator inside the tooltip when you mouseover. In certain cases the regulatory influence is predicted to be the result of the combination of two influences. These are indicated as combiner in the column labeled "Operator".
For transcription factors, an additional table next to regulator table will be show. This table show modules that are influenced by the transcription factor.
Motifs Tab
Network inference algorithm uses de novo motif prediction for assigning genes to modules. If there are any motifs identified in the upstream region of a gene, the motif will be shown here. For each motif sequence logo, consensus and e-value will be shown.
Functions Tab
Identification of functional enrichment for the module members is important in associating predicted motifs and regulatory influences with pathways. As described above, the network inference pipeline includes a functional enrichment module by which hypergeometric p-values are used to identify over representation of functional ontology terms among module members.
Network Portal presents functional ontologies from KEGG, GO, TIGRFAM, and COG as separate tables that include function name, type, corrected and uncorrected hypergeometric p-values, and the number of genes assigned to this category out of total number of genes in the module.
Module Members Tab
Identity of gene members in a module may help to identify potential interactions between different functional modules. Therefore, neighbor genes that share the same module(s) with gene under consideration are shown here. For each memebr, gene name, description and modules that contain it are listed.
Help Tab
This help page. More general help can be accessed by clicking help menu in the main navigation bar.
CircVis
Our circular module explorer is adapted from visquick originally developed by Dick Kreisberg of Ilya Shmulevich lab at ISB for The Cancer Genome Atlas. We use simplified version of visquick to display distribution of module members and their interactions across the genome. This view provides summary of regulation information for a gene. The main components are;
- 1. All genomic elements for the organism are represented as a circle and each element is separated by black tick marks. In this example chromosome and pDV represent main chromosome and plasmid for D. vulgaris Hildenborough, respectively.
- 2. Source gene
- 3. Target genes (other module members)
- 4. Interactions between source and target genes for a particular module
- 5. Module(s) that source gene and target genes belong to
- 6. Visualisation legend
Comments for BSU07600
Please add your comments for this gene by using the form below. Your comments will be publicly available.comments powered by Disqus
Social Tab
Network Portal is designed to promote collaboration through social interactions. Therefore interested researchers can share information, questions and updates for a particular gene.
Users can use their Disqus, Facebook, Twitter or Google accounts to connect to this page (We recommend Google). Each module and gene page includes comments tab that lists history of the interactions for that gene. You can browse the history, make updates, raise questions and share these activities with social web.
In the next releases of the network portal, we are planning to create personal space for each user where you can share you space that contains all the analysis steps you did along with relevant information.