mutation predictions | marginal predictions | summary statistics | genome diff | command line log
STRAIN: MT1131 |
GO TO MAIN |
|
breseq version 0.22
mutation predictions | marginal predictions | summary statistics | genome diff | command line log |
| Predicted mutations | |||||||
|---|---|---|---|---|---|---|---|
| evidence | seq id | position | mutation | freq | annotation | gene | description |
| RA | NC_014034 | 43,641 | C→G | 100% | V770L (GTC→CTC) | RCAP_rcc00037 ← | UvrD/REP helicase |
| RA | NC_014034 | 45,670 | C→A | 100% | E93D (GAG→GAT) | RCAP_rcc00037 ← | UvrD/REP helicase |
| RA | NC_014034 | 54,149 | C→A | 100% | intergenic (‑11/‑78) | regB ← / → senC | sensor histidine kinase RegB/electron transport protein SenC |
| RA | NC_014034 | 66,351 | C→A | 100% | D506E (GAC→GAA) | flhA → | flagellar biosynthesis protein FlhA |
| RA | NC_014034 | 66,387 | T→G | 100% | S518S (TCT→TCG) | flhA → | flagellar biosynthesis protein FlhA |
| RA | NC_014034 | 68,973 | A→G | 100% | E66E (GAA→GAG) | RCAP_rcc00059 → | hypothetical protein |
| RA | NC_014034 | 71,452 | Δ1 bp | 100% | coding (42/591 nt) | gidB ← | methyltransferase GidB |
| RA | NC_014034 | 74,095 | A→C | 100% | F196L (TTT→TTG) | trmE ← | tRNA modification GTPase TrmE |
| RA | NC_014034 | 76,977 | G→T | 100% | intergenic (‑389/‑7) | RCAP_rcc00066 ← / → RCAP_rcc00067 | hypothetical protein/Maf‑like protein |
| RA | NC_014034 | 76,989 | G→T | 100% | L2L (CTG→CTT) | RCAP_rcc00067 → | Maf‑like protein |
| RA | NC_014034 | 78,028 | G→A | 100% | G150E (GGG→GAG) | aroE → | shikimate 5‑dehydrogenase |
| RA | NC_014034 | 106,464 | G→C | 100% | P24A (CCC→GCC) | hmuR ← | TonB‑dependent hemin receptor |
| RA | NC_014034 | 109,508 | C→G | 100% | G118A (GGC→GCC) | RCAP_rcc00102 ← | ABC transporter permease |
| RA | NC_014034 | 111,564 | C→G | 100% | G110A (GGC→GCC) | RCAP_rcc00104 ← | hypothetical protein |
| RA | NC_014034 | 137,198 | 2 bp→CG | 100% | coding (865‑866/2064 nt) | RCAP_rcc00130 → | radical SAM family protein |
| RA | NC_014034 | 184,637 | T→C | 100% | M1202M (ATG→GTG) | gltB ← | glutamate synthase (NADPH) subunit alpha |
| RA | NC_014034 | 206,168 | Δ1 bp | 100% | coding (631/849 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| RA | NC_014034 | 206,198 | Δ1 bp | 100% | coding (601/849 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| RA | NC_014034 | 206,226 | Δ1 bp | 100% | coding (573/849 nt) | rfbD ← | dTDP‑4‑dehydrorhamnose reductase |
| RA | NC_014034 | 221,949 | C→A | 5.1% | E236D (GAG→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,958 | A→G | 10.9% | D233D (GAT→GAC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,964 | C→G | 2.4% | P231P (CCG→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,967 | G→A | 55.8% | D230D (GAC→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,973 | G→A | 1.4% | P228P (CCC→CCT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,976 | A→G | 3.0% | D227D (GAT→GAC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,979 | G→C | 2.6% | T226T (ACC→ACG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,985 | G→A | 32.4% | D224D (GAC→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,991 | G→C | 2.5% | P222P (CCC→CCG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,994 | A→G | 1.6% | D221D (GAT→GAC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 221,997 | G→C | 1.5% | T220T (ACC→ACG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,000 | C→G | 3.0% | P219P (CCG→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,009 | G→A | 7.5% | P216P (CCC→CCT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,012 | A→G | 3.5% | D215D (GAT→GAC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,015 | G→C | 3.8% | T214T (ACC→ACG) | RCAP_rcc00185 ← | hypothetical protein |
| JC | NC_014034 | 222,019 | 27 bp x 2 | 100% | duplication | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,021 | G→A | 19.0% | D212D (GAC→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,027 | G→C | 11.1% | P210P (CCC→CCG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,036 | C→G | 3.0% | P207P (CCG→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,045 | G→C | 6.1% | P204P (CCC→CCG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,048 | A→G | 2.7% | D203D (GAT→GAC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,051 | G→C | 1.7% | T202T (ACC→ACG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,054 | C→G | 1.1% | P201P (CCG→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| JC | NC_014034 | 222,056 | +ATCCGTGGGATCGGTCGGGTCCGTGGGATCGGTCGGATCCGTGGGATCGGTCGGGTCCGTGGGATCGGTCGGATCCGTGGGATCGGTCGG | 100% | coding (601/2748 nt) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,057 | G→A | 10.2% | D200D (GAC→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,063 | A→G | 100% | P198P (CCT→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,066 | A→G | 1.4% | D197D (GAT→GAC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,069 | G→C | 26.4% | T196T (ACC→ACG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,072 | C→G | 32.7% | P195P (CCG→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,075 | G→A | 5.4% | D194D (GAC→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,078 | C→G | 1.9% | T193T (ACG→ACC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,081 | C→G | 8.5% | P192P (CCG→CCC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,084 | G→A | 12.4% | D191D (GAC→GAT) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,087 | C→G | 11.3% | T190T (ACG→ACC) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,090 | G→C | 8.8% | P189P (CCC→CCG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 222,096 | G→C | 1.6% | T187T (ACC→ACG) | RCAP_rcc00185 ← | hypothetical protein |
| RA | NC_014034 | 235,595 | +C | 97.2% | intergenic (+24/+187) | RCAP_rcc00200 → / ← RCAP_rcc00201 | MarR family transcriptional regulator/adenine‑specific DNA‑methyltransferase |
| RA | NC_014034 | 243,127 | A→G | 100% | E28E (GAA→GAG) | mogA → | molybdopterin biosynthesis mog protein |
| RA | NC_014034 | 257,090 | C→G | 100% | intergenic (+24/‑175) | secA → / → RCAP_rcc00221 | preprotein translocase subunit SecA/hypothetical protein |
| RA | NC_014034 | 265,743 | T→C | 100% | E229E (GAA→GAG) | lpxK ← | tetraacyldisaccharide 4'‑kinase |
| RA | NC_014034 | 279,645 | +A | 3.8% | intergenic (‑47/‑33) | RCAP_rcc00242 ← / → dapD | hypothetical protein/2,3,4,5‑tetrahydropyridine‑2,6‑dicarboxylate N‑succinyltransferase |
| RA | NC_014034 | 290,303 | Δ1 bp | 2.3% | intergenic (‑36/+14) | RCAP_rcc00253 ← / ← RCAP_rcc00254 | major facilitator superfamily protein/hypothetical protein |
| RA | NC_014034 | 296,315 | Δ1 bp | 100% | intergenic (‑115/‑168) | RCAP_rcc00258 ← / → RCAP_rcc00259 | lipoprotein/porin family protein |
| RA | NC_014034 | 296,324 | Δ1 bp | 100% | intergenic (‑124/‑159) | RCAP_rcc00258 ← / → RCAP_rcc00259 | lipoprotein/porin family protein |
| RA | NC_014034 | 296,443 | Δ1 bp | 100% | intergenic (‑243/‑40) | RCAP_rcc00258 ← / → RCAP_rcc00259 | lipoprotein/porin family protein |
| RA | NC_014034 | 297,475 | Δ1 bp | 100% | intergenic (+42/‑52) | RCAP_rcc00259 → / → RCAP_rcc00260 | porin family protein/alanine racemase domain‑containing protein |
| RA | NC_014034 | 297,560 | A→G | 100% | K12E (AAG→GAG) | RCAP_rcc00260 → | alanine racemase domain‑containing protein |
| RA | NC_014034 | 300,681 | G→A | 100% | intergenic (+34/+110) | RCAP_rcc00263 → / ← RCAP_rcc00264 | winged helix family two component transcriptional regulator/hypothetical protein |
| RA | NC_014034 | 300,961 | G→C | 100% | Q59E (CAG→GAG) | RCAP_rcc00264 ← | hypothetical protein |
| RA | NC_014034 | 310,392 | T→G | 7.9% | T378P (ACC→CCC) | RCAP_rcc00272 ← | heparinase II/III family protein |
| RA | NC_014034 | 317,927 | A→G | 100% | K338E (AAG→GAG) | RCAP_rcc00280 → | hemolysin‑type calcium‑binding repeat family protein |
| RA | NC_014034 | 318,474 | G→C | 100% | intergenic (+102/+53) | rpsO → / ← RCAP_rcc00282 | 30S ribosomal protein S15/aldehyde dehydrogenase |
| RA | NC_014034 | 348,680 | G→A | 100% | A41T (GCG→ACG) | rpsH → | 30S ribosomal protein S8 |
| RA | NC_014034 | 362,657 | G→A | 100% | G228G (GGG→GGA) | RCAP_rcc00334 → | ATP12 chaperone protein family |
| RA | NC_014034 | 362,920 | C→T | 100% | A5V (GCA→GTA) | bztA → | glutamate/aspartate ABC transporter periplasmic glutamate/aspartate‑binding protein BztA |
| RA | NC_014034 | 367,286 | G→A | 100% | A214T (GCC→ACC) | bztD → | glutamate/aspartate ABC transporter ATP‑binding protein BztD |
| RA | NC_014034 | 367,383 | G→A | 100% | R246H (CGC→CAC) | bztD → | glutamate/aspartate ABC transporter ATP‑binding protein BztD |
| RA | NC_014034 | 386,422 | A→G | 100% | F630F (TTT→TTC) | macB ← | macrolide export ABC transporter ATP‑binding/permease MacB |
| RA | NC_014034 | 395,603 | G→C | 100% | P136A (CCC→GCC) | RCAP_rcc00369 ← | GNAT family acetyltransferase |
| RA | NC_014034 | 395,628 | C→T | 100% | K127K (AAG→AAA) | RCAP_rcc00369 ← | GNAT family acetyltransferase |
| RA | NC_014034 | 395,641 | G→A | 100% | S123F (TCC→TTC) | RCAP_rcc00369 ← | GNAT family acetyltransferase |
| RA | NC_014034 | 398,935 | C→T | 100% | E381K (GAA→AAA) | RCAP_rcc00372 ← | hypothetical protein |
| RA | NC_014034 | 398,947 | A→G | 100% | S377P (TCG→CCG) | RCAP_rcc00372 ← | hypothetical protein |
| RA | NC_014034 | 400,749 | C→G | 100% | G375G (GGG→GGC) | mdoH ← | glucans biosynthesis glucosyltransferase H |
| RA | NC_014034 | 407,119 | G→C | 100% | G39G (GGG→GGC) | glnA1 → | glutamine synthetase |
| RA | NC_014034 | 408,487 | Δ1 bp | 100% | intergenic (+105/+43) | glnA1 → / ← dapA | glutamine synthetase/dihydrodipicolinate synthase |
| RA | NC_014034 | 408,497 | +G | 85.5% | intergenic (+115/+33) | glnA1 → / ← dapA | glutamine synthetase/dihydrodipicolinate synthase |
| RA | NC_014034 | 408,497 | +C | 85.5% | intergenic (+115/+33) | glnA1 → / ← dapA | glutamine synthetase/dihydrodipicolinate synthase |
| RA | NC_014034 | 408,497 | +A | 85.5% | intergenic (+115/+33) | glnA1 → / ← dapA | glutamine synthetase/dihydrodipicolinate synthase |
| RA | NC_014034 | 408,497 | +G | 85.5% | intergenic (+115/+33) | glnA1 → / ← dapA | glutamine synthetase/dihydrodipicolinate synthase |
| RA | NC_014034 | 408,497 | +A | 85.5% | intergenic (+115/+33) | glnA1 → / ← dapA | glutamine synthetase/dihydrodipicolinate synthase |
| RA | NC_014034 | 418,190 | T→G | 100% | S75A (TCC→GCC) | RCAP_rcc00388 → | OmpA/MotB domain‑containing protein |
| RA | NC_014034 | 419,739 | C→A | 100% | T591N (ACC→AAC) | RCAP_rcc00388 → | OmpA/MotB domain‑containing protein |
| RA | NC_014034 | 426,673 | T→C | 100% | E7G (GAG→GGG) | RCAP_rcc00396 ← | hypothetical protein |
| RA | NC_014034 | 428,887 | C→G | 100% | L49L (CTG→CTC) | RCAP_rcc00399 ← | hypothetical protein |
| RA | NC_014034 | 429,595 | T→G | 100% | R133R (AGG→CGG) | pyrB ← | aspartate carbamoyltransferase |
| RA | NC_014034 | 432,425 | +C | 100% | intergenic (+28/+120) | RCAP_rcc00403 → / ← RCAP_rcc00404 | hypothetical protein/Sua5/YciO/YrdC/YwlC family protein |
| RA | NC_014034 | 432,493 | C→G | 2.8% | intergenic (+96/+52) | RCAP_rcc00403 → / ← RCAP_rcc00404 | hypothetical protein/Sua5/YciO/YrdC/YwlC family protein |
| RA | NC_014034 | 432,503 | G→A | 2.9% | intergenic (+106/+42) | RCAP_rcc00403 → / ← RCAP_rcc00404 | hypothetical protein/Sua5/YciO/YrdC/YwlC family protein |
| RA | NC_014034 | 441,868 | T→G | 100% | V329G (GTC→GGC) | gabD → | succinate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 444,483 | C→G | 100% | L51L (CTG→CTC) | RCAP_rcc00416 ← | LysR family transcriptional regulator |
| RA | NC_014034 | 445,294 | G→T | 100% | G168V (GGC→GTC) | RCAP_rcc00417 → | hypothetical protein |
| RA | NC_014034 | 445,317 | G→T | 100% | M176M (GTG→TTG) | RCAP_rcc00417 → | hypothetical protein |
| RA | NC_014034 | 460,763 | T→C | 100% | intergenic (‑193/+203) | creA ← / ← mdtB | creatinase/multidrug resistance protein MdtB |
| RA | NC_014034 | 465,510 | +G | 100% | coding (51/384 nt) | RCAP_rcc00434 → | hypothetical protein |
| RA | NC_014034 | 465,577 | +C | 100% | coding (118/384 nt) | RCAP_rcc00434 → | hypothetical protein |
| RA | NC_014034 | 482,368 | G→C | 100% | G423A (GGC→GCC) | RCAP_rcc00448 → | sporulation domain‑containing protein |
| RA | NC_014034 | 483,709 | G→C | 100% | H13Q (CAC→CAG) | RCAP_rcc00449 ← | hypothetical protein |
| RA | NC_014034 | 484,647 | G→C | 100% | L232F (TTG→TTC) | RCAP_rcc00450 → | hypothetical protein |
| RA | NC_014034 | 491,969 | A→C | 100% | M37L (ATT→CTT) | RCAP_rcc00459 → | glutathione S‑transferase |
| RA | NC_014034 | 500,694 | G→C | 100% | T699T (ACG→ACC) | glnD → | PII uridylyl‑transferase |
| RA | NC_014034 | 510,933 | +C | 100% | coding (104/837 nt) | RCAP_rcc00476 ← | hypothetical protein |
| RA | NC_014034 | 513,941 | Δ1 bp | 100% | coding (1662/1929 nt) | mcpI ← | methyl‑accepting chemotaxis protein McpI |
| RA | NC_014034 | 520,634 | C→G | 100% | M210M (GTG→CTG) | fsr ← | fosmidomycin resistance protein |
| RA | NC_014034 | 530,939 | +T | 100% | intergenic (+17/+124) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 530,939 | +G | 2.3% | intergenic (+17/+124) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 530,940 | C→G | 100% | intergenic (+18/+123) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 530,942 | G→C | 100% | intergenic (+20/+121) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 530,944 | G→C | 100% | intergenic (+22/+119) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 530,946 | T→C | 100% | intergenic (+24/+117) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 530,950 | C→T | 100% | intergenic (+28/+113) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| RA | NC_014034 | 531,029 | 2 bp→GC | 100% | intergenic (+107/+33) | valS → / ← RCAP_rcc00497 | valyl‑tRNA synthetase/UbiA prenyltransferase |
| JC | NC_014034 | 534,021 | +CGCCTT | 100% | intergenic (+28/‑161) | RCAP_rcc00499 → / → RCAP_rcc00500 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 537,497 | T→C | 100% | M182M (TTG→CTG) | RCAP_rcc00503 → | OmpA/MotB domain‑containing protein |
| RA | NC_014034 | 539,743 | T→G | 100% | Y201D (TAC→GAC) | RCAP_rcc00505 → | type II secretion system protein E |
| RA | NC_014034 | 547,182 | Δ1 bp | 100% | intergenic (‑48/+64) | RCAP_rcc00512 ← / ← etfD | hypothetical protein/electron transfer flavoprotein‑ubiquinone oxidoreductase |
| RA | NC_014034 | 549,057 | G→C | 100% | intergenic (‑150/‑103) | etfD ← / → greA | electron transfer flavoprotein‑ubiquinone oxidoreductase/transcription elongation factor GreA |
| RA | NC_014034 | 549,629 | Δ1 bp | 100% | coding (470/471 nt) | greA → | transcription elongation factor GreA |
| RA | NC_014034 | 550,000 | G→A | 100% | A115T (GCC→ACC) | RCAP_rcc00515 → | hypothetical protein |
| RA | NC_014034 | 559,029 | Δ1 bp | 100% | intergenic (+78/+29) | dcp → / ← fieF | peptidyl‑dipeptidase Dcp/ferrous‑iron efflux pump FieF |
| RA | NC_014034 | 562,322 | T→C | 100% | E21E (GAA→GAG) | RCAP_rcc00525 ← | hypothetical protein |
| RA | NC_014034 | 565,570 | C→T | 100% | G206D (GGT→GAT) | RCAP_rcc00527 ← | family 25 glycosyl hydrolase |
| RA | NC_014034 | 566,409 | A→G | 100% | F80L (TTC→CTC) | RCAP_rcc00528 ← | carboxymuconolactone decarboxylase |
| RA | NC_014034 | 568,802 | Δ1 bp | 7.8% | intergenic (‑98/+68) | RCAP_rcc00530 ← / ← carB | hypothetical protein/carbamoyl‑phosphate synthase large subunit |
| RA | NC_014034 | 580,954 | +A | 100% | intergenic (+75/‑296) | RCAP_rcc00541 → / → RCAP_rcc00542 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 582,189 | G→C | 100% | intergenic (+19/+69) | RCAP_rcc00543 → / ← RCAP_rcc00544 | hypothetical protein/aldehyde dehydrogenase |
| RA | NC_014034 | 582,254 | G→C | 100% | intergenic (+84/+4) | RCAP_rcc00543 → / ← RCAP_rcc00544 | hypothetical protein/aldehyde dehydrogenase |
| RA | NC_014034 | 583,706 | C→A | 100% | A298S (GCG→TCG) | RCAP_rcc00544 ← | aldehyde dehydrogenase |
| RA | NC_014034 | 583,709 | T→A | 100% | S297C (AGT→TGT) | RCAP_rcc00544 ← | aldehyde dehydrogenase |
| RA | NC_014034 | 586,502 | +G | 100% | intergenic (‑4/+31) | RCAP_rcc00547 ← / ← RCAP_rcc00548 | glutaredoxin family protein/BolA family protein |
| RA | NC_014034 | 586,917 | +G | 100% | intergenic (‑145/+37) | RCAP_rcc00548 ← / ← purL | BolA family protein/phosphoribosylformylglycinamidine synthase II |
| RA | NC_014034 | 590,814 | C→G | 100% | Q56E (CAA→GAA) | murI → | glutamate racemase |
| RA | NC_014034 | 619,206 | T→C | 100% | Y66C (TAC→TGC) | cbbQ ← | CbbQ protein |
| RA | NC_014034 | 625,791 | G→C | 100% | R533R (CGG→CGC) | anfA → | nitrogen fixation regulatory protein AnfA |
| RA | NC_014034 | 653,416 | C→T | 100% | intergenic (+75/‑42) | RCAP_rcc00609 → / → RCAP_rcc00610 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 653,425 | G→C | 100% | intergenic (+84/‑33) | RCAP_rcc00609 → / → RCAP_rcc00610 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 678,414 | G→C | 100% | H1731Q (CAC→CAG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,518 | T→C | 3.0% | T1697A (ACG→GCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,521 | C→T | 2.7% | G1696S (GGC→AGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,522 | A→C | 2.8% | F1695L (TTT→AGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,525 | G→C | 2.8% | A1694A (GCC→GCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,531 | C→G | 2.8% | L1692L (CTG→CTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,550 | G→C | 3.4% | A1686G (GCG→GGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,553 | G→C | 3.4% | T1685S (ACC→AGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,554 | T→C | 3.3% | T1685A (ACC→GCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,564 | G→A | 3.3% | S1681S (AGC→AGT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,567 | C→G | 3.1% | S1680S (TCG→TCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,569 | A→C | 3.2% | S1680A (TCG→GCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,585 | C→A | 3.0% | A1674A (GCG→GCT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,588 | C→G | 3.1% | T1673T (ACG→ACC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,593 | T→C | 3.0% | S1672G (AGC→GGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,753 | C→G | 3.5% | A1618A (GCG→GCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,771 | G→A | 5.9% | I1612I (ATC→ATT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,773 | T→C | 5.6% | M1612V (ATC→GTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,779 | C→T | 7.1% | A1610T (GCG→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,780 | C→G | 6.1% | T1609T (ACG→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,781 | G→C | 6.1% | T1609R (ACG→ACC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,783 | G→C | 6.4% | S1608R (AGC→ACC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,784 | C→G | 6.2% | S1608T (AGC→ACC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,785 | T→A | 6.0% | S1608C (AGC→TGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,793 | G→A | 6.5% | A1605V (GCG→GTA) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,794 | C→G | 6.5% | A1605P (GCG→CCA) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,795 | G→A | 6.4% | I1604I (ATC→CCA) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,797 | T→G | 6.3% | M1604L (ATC→CTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,806 | C→A | 6.4% | A1601S (GCG→TCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,809 | T→C | 6.6% | S1600G (AGC→GGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,814 | C→G | 6.5% | R1598P (CGG→CCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,815 | G→C | 6.5% | R1598G (CGG→GGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,816 | T→C | 6.4% | A1597A (GCA→GGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 678,831 | G→C | 6.3% | T1592T (ACC→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 679,213 | G→C | 100% | A1465G (GCC→GGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 679,222 | C→G | 100% | G1462A (GGG→GCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,120 | G→C | 42.5% | V829V (GTC→GTG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,129 | A→G | 36.3% | D826D (GAT→GAC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,130 | T→C | 35.4% | D826G (GAT→GGT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,135 | G→C | 11.4% | G824G (GGC→GGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,136 | C→G | 10.5% | G824A (GGC→GCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,137 | C→A | 10.5% | G824C (GGC→TGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,138 | G→C | 10.4% | L823L (CTC→TGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,141 | G→C | 9.6% | G822G (GGC→GGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,149 | T→G | 7.6% | M820L (ATC→CTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,441 | C→G | 7.9% | A722A (GCG→GCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,444 | C→G | 8.0% | A721A (GCG→GCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,446 | C→T | 9.1% | A721T (GCG→ACT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,447 | C→T | 9.0% | E720E (GAG→ACT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,450 | G→C | 8.6% | L719L (CTC→CTG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,459 | G→A | 20.0% | I716I (ATC→ATT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,461 | T→C | 19.3% | M716V (ATC→GTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,471 | G→C | 21.0% | T712T (ACC→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,473 | T→A | 20.9% | T712S (ACC→TCC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,480 | G→C | 20.3% | G709G (GGC→GGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,491 | C→T | 22.3% | A706T (GCG→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,501 | A→C | 23.2% | R702R (CGT→CGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,502 | C→G | 23.5% | R702P (CGT→CCT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,503 | G→C | 23.9% | R702G (CGT→GGT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,546 | A→G | 7.9% | F687F (TTT→TTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,548 | A→G | 7.9% | F687L (TTT→CTT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,552 | G→C | 4.6% | R685R (CGC→CGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,553 | C→T | 4.4% | R685H (CGC→CAC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,554 | G→T | 4.5% | R685S (CGC→AGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,561 | C→A | 2.6% | A682A (GCG→GCT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,562 | G→T | 2.6% | A682E (GCG→GAG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,563 | C→T | 2.6% | A682T (GCG→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,567 | G→A | 2.5% | G680G (GGC→GGT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,569 | C→T | 2.6% | G680S (GGC→AGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,578 | C→T | 2.8% | A677T (GCG→ACG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,583 | G→C | 2.7% | T675R (ACG→AGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,590 | A→T | 2.8% | S673T (TCG→ATG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,592 | G→T | 2.8% | A672D (GCT→ATG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,593 | C→T | 2.8% | A672T (GCT→ACT) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 681,689 | T→C | 9.8% | S640G (AGC→GGC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,521 | G→C | 6.8% | A362A (GCC→GCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,541 | T→C | 10.8% | M356M (ATG→GTG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,546 | G→T | 11.0% | A354E (GCG→GAG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,547 | C→G | 11.8% | A354P (GCG→CGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,549 | C→G | 11.2% | G353A (GGG→CGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,550 | C→A | 11.2% | G353W (GGG→TGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,556 | G→T | 10.8% | M351M (CTG→ATG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,565 | Δ1 bp | 9.8% | coding (1042/6438 nt) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,567 | T→C | 9.9% | E347G (GAA→GGA) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,568 | C→T | 9.6% | E347K (GAA→AAA) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,573 | +C | 9.5% | coding (1034/6438 nt) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,576 | C→G | 9.3% | S344T (AGC→ACC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,582 | C→G | 9.9% | G342A (GGG→GCG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,585 | G→A | 9.9% | A341V (GCC→GTG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,587 | C→G | 9.7% | M340I (ATG→GTG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,593 | C→G | 9.5% | E338D (GAG→GAC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,594 | T→C | 9.5% | E338G (GAG→GGG) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 682,611 | C→G | 6.1% | L332L (CTG→CTC) | RCAP_rcc00630 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 690,867 | A→C | 100% | H109Q (CAT→CAG) | RCAP_rcc00636 ← | hypothetical protein |
| RA | NC_014034 | 699,254 | C→G | 100% | G278G (GGG→GGC) | RCAP_rcc00640 ← | S1/S6 family peptidase |
| RA | NC_014034 | 702,786 | G→C | 100% | R812R (CGC→CGG) | RCAP_rcc00643 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 751,864 | G→A | 100% | A331T (GCG→ACG) | crtB → | phytoene synthase |
| RA | NC_014034 | 753,946 | C→T | 100% | G379D (GGC→GAC) | crtD ← | methoxyneurosporene dehydrogenase |
| RA | NC_014034 | 774,615 | C→G | 100% | intergenic (‑69/+51) | oppB1 ← / ← oppA1 | oligopeptide ABC transporter permease OppB/oligopeptide ABC transporter periplasmic oligopeptide‑binding protein OppA |
| RA | NC_014034 | 774,619 | 2 bp→GG | 100% | intergenic (‑73/+46) | oppB1 ← / ← oppA1 | oligopeptide ABC transporter permease OppB/oligopeptide ABC transporter periplasmic oligopeptide‑binding protein OppA |
| RA | NC_014034 | 774,625 | A→G | 100% | intergenic (‑79/+41) | oppB1 ← / ← oppA1 | oligopeptide ABC transporter permease OppB/oligopeptide ABC transporter periplasmic oligopeptide‑binding protein OppA |
| RA | NC_014034 | 774,641 | +A | 7.1% | intergenic (‑95/+25) | oppB1 ← / ← oppA1 | oligopeptide ABC transporter permease OppB/oligopeptide ABC transporter periplasmic oligopeptide‑binding protein OppA |
| RA | NC_014034 | 774,645 | G→C | 100% | intergenic (‑99/+21) | oppB1 ← / ← oppA1 | oligopeptide ABC transporter permease OppB/oligopeptide ABC transporter periplasmic oligopeptide‑binding protein OppA |
| RA | NC_014034 | 781,257 | A→G | 100% | intergenic (+11/+25) | hipO → / ← RCAP_rcc00711 | hippurate hydrolase/universal stress family protein |
| RA | NC_014034 | 781,265 | A→G | 100% | intergenic (+19/+17) | hipO → / ← RCAP_rcc00711 | hippurate hydrolase/universal stress family protein |
| RA | NC_014034 | 797,964 | G→C | 100% | G183G (GGG→GGC) | sucB → | dihydrolipoyllysine‑residue succinyltransferase |
| RA | NC_014034 | 803,353 | +G | 100% | intergenic (+50/‑290) | maoC → / → sdhC | MaoC domain‑containing protein/succinate dehydrogenase, cytochrome b556 subunit |
| RA | NC_014034 | 818,858 | +G | 100% | intergenic (+109/+241) | RCAP_rcc00749 → / ← pyrG | LysR family transcriptional regulator/CTP synthase |
| RA | NC_014034 | 819,041 | C→G | 100% | intergenic (+292/+58) | RCAP_rcc00749 → / ← pyrG | LysR family transcriptional regulator/CTP synthase |
| RA | NC_014034 | 826,038 | Δ1 bp | 4.0% | coding (410/672 nt) | thiN → | thiamine pyrophosphokinase |
| RA | NC_014034 | 833,231 | C→A | 100% | G35V (GGC→GTC) | mcpA1 ← | methyl‑accepting chemotaxis protein McpA |
| RA | NC_014034 | 834,164 | A→G | 100% | intergenic (‑830/‑236) | mcpA1 ← / → hoxH | methyl‑accepting chemotaxis protein McpA/NAD‑reducing hydrogenase HoxS subunit beta |
| RA | NC_014034 | 834,953 | C→G | 100% | P185R (CCC→CGC) | hoxH → | NAD‑reducing hydrogenase HoxS subunit beta |
| RA | NC_014034 | 835,278 | G→C | 100% | G293G (GGG→GGC) | hoxH → | NAD‑reducing hydrogenase HoxS subunit beta |
| RA | NC_014034 | 840,920 | C→G | 100% | G188G (GGC→GGG) | hypF → | hydrogenase maturation protein HypF |
| RA | NC_014034 | 861,642 | G→A | 100% | A809T (GCC→ACC) | RCAP_rcc00783 → | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 870,515 | +CCC | 100% | coding (1150/2331 nt) | xdhB ← | xanthine dehydrogenase molybdopterin binding subunit |
| RA | NC_014034 | 884,973 | T→C | 100% | G278G (GGA→GGG) | mreC ← | rod shape‑determining protein MreC |
| RA | NC_014034 | 895,555 | G→C | 100% | P71A (CCG→GCG) | hda ← | DnaA‑like protein Hda |
| RA | NC_014034 | 900,674 | G→C | 100% | intergenic (‑3/‑284) | ldh ← / → ftsW | L‑lactate dehydrogenase/cell division protein FtsW |
| RA | NC_014034 | 900,737 | +C | 100% | intergenic (‑66/‑221) | ldh ← / → ftsW | L‑lactate dehydrogenase/cell division protein FtsW |
| RA | NC_014034 | 900,742 | +C | 100% | intergenic (‑71/‑216) | ldh ← / → ftsW | L‑lactate dehydrogenase/cell division protein FtsW |
| RA | NC_014034 | 900,796 | 1 bp→GGGG | 100% | intergenic (‑125/‑162) | ldh ← / → ftsW | L‑lactate dehydrogenase/cell division protein FtsW |
| RA | NC_014034 | 900,802 | +CC | 100% | intergenic (‑131/‑156) | ldh ← / → ftsW | L‑lactate dehydrogenase/cell division protein FtsW |
| RA | NC_014034 | 902,083 | A→C | 100% | K376Q (AAA→CAA) | ftsW → | cell division protein FtsW |
| RA | NC_014034 | 904,926 | Δ1 bp | 100% | intergenic (+30/‑166) | RCAP_rcc00821 → / → murB | hypothetical protein/UDP‑N‑acetylmuramate dehydrogenase |
| RA | NC_014034 | 904,934 | +GC | 100% | intergenic (+38/‑158) | RCAP_rcc00821 → / → murB | hypothetical protein/UDP‑N‑acetylmuramate dehydrogenase |
| RA | NC_014034 | 907,056 | A→G | 100% | A22A (GCA→GCG) | ftsQ → | cell division protein FtsQ |
| RA | NC_014034 | 913,900 | A→G | 100% | E177E (GAA→GAG) | recN → | DNA repair protein RecN |
| RA | NC_014034 | 925,909 | +C | 91.5% | intergenic (+162/+12) | RCAP_rcc00838 → / ← glcB | DnaJ domain‑containing protein/malate synthase |
| RA | NC_014034 | 963,936 | +CCCC | 100% | intergenic (+23/‑78) | RCAP_rcc00874 → / → atzB | inositol monophosphatase/hydroxydechloroatrazine ethylaminohydrolase |
| RA | NC_014034 | 970,615 | T→C | 100% | I149I (ATT→ATC) | RCAP_rcc00881 → | metallophosphoesterase |
| RA | NC_014034 | 974,265 | +C | 100% | intergenic (+145/+114) | RCAP_rcc00884 → / ← RCAP_rcc00885 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 974,361 | C→G | 100% | intergenic (+241/+18) | RCAP_rcc00884 → / ← RCAP_rcc00885 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 985,674 | 2 bp→GG | 100% | intergenic (+13/‑70) | betB → / → betA | betaine‑aldehyde dehydrogenase/choline dehydrogenase |
| RA | NC_014034 | 985,690 | Δ1 bp | 100% | intergenic (+29/‑55) | betB → / → betA | betaine‑aldehyde dehydrogenase/choline dehydrogenase |
| JC | NC_014034 | 996,774 | +AACCGCGGCGAGATCGCC | 100% | coding (24/1986 nt) | pccA → | propionyl‑CoA carboxylase subunit alpha |
| RA | NC_014034 | 1,003,050 | +G | 2.3% | coding (356/738 nt) | pssA → | CDP‑diacylglycerol‑‑serine O‑phosphatidyltransferase |
| RA | NC_014034 | 1,013,089 | A→G | 100% | A363A (GCT→GCC) | RCAP_rcc00919 ← | hypothetical protein |
| RA | NC_014034 | 1,023,586 | C→G | 100% | W195S (TGG→TCG) | RCAP_rcc00928 ← | hypothetical protein |
| RA | NC_014034 | 1,065,845 | +C | 100% | intergenic (‑17/+117) | RCAP_rcc00969 ← / ← RCAP_rcc00970 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 1,083,749 | C→G | 100% | V169V (GTG→GTC) | gam ← | host‑nuclease inhibitor protein Gam |
| RA | NC_014034 | 1,086,542 | G→T | 100% | P584T (CCG→ACG) | RCAP_rcc01002 ← | integrase catalytic subunit |
| RA | NC_014034 | 1,106,648 | C→G | 100% | A226G (GCG→GGG) | RCAP_rcc01028 → | iron siderophore/cobalamin ABC transporter periplasmic iron siderophore/cobalamin‑binding protein |
| RA | NC_014034 | 1,125,875 | +C | 100% | coding (347/1044 nt) | RCAP_rcc01046 ← | iron siderophore/cobalamin ABC transporter permease |
| RA | NC_014034 | 1,125,877 | +C | 100% | coding (345/1044 nt) | RCAP_rcc01046 ← | iron siderophore/cobalamin ABC transporter permease |
| RA | NC_014034 | 1,125,879 | +C | 100% | coding (343/1044 nt) | RCAP_rcc01046 ← | iron siderophore/cobalamin ABC transporter permease |
| RA | NC_014034 | 1,125,955 | G→C | 100% | A89A (GCC→GCG) | RCAP_rcc01046 ← | iron siderophore/cobalamin ABC transporter permease |
| RA | NC_014034 | 1,133,241 | A→G | 100% | S241S (TCA→TCG) | gvpN → | gas vesicle protein GvpN |
| RA | NC_014034 | 1,135,285 | C→A | 100% | P113H (CCT→CAT) | RCAP_rcc01056 → | gas vesicle synthesis protein GvpL/GvpF |
| RA | NC_014034 | 1,143,585 | G→C | 100% | V216L (GTC→CTC) | RCAP_rcc01071 → | hypothetical protein |
| RA | NC_014034 | 1,145,463 | C→G | 100% | H512D (CAT→GAT) | hutH → | histidine ammonia‑lyase |
| RA | NC_014034 | 1,193,628 | +GGG | 100% | intergenic (+93/‑158) | metK → / → trmB | methionine adenosyltransferase/tRNA (guanine‑N(7)‑)‑methyltransferase |
| RA | NC_014034 | 1,200,794 | +G | 100% | intergenic (+3/‑114) | trpF → / → trpB1 | phosphoribosylanthranilate isomerase/tryptophan synthase subunit beta |
| RA | NC_014034 | 1,201,931 | T→A | 100% | S342T (TCC→ACC) | trpB1 → | tryptophan synthase subunit beta |
| RA | NC_014034 | 1,202,696 | Δ1 bp | 100% | intergenic (+556/‑308) | trpB1 → / → RCAP_rcc01130 | tryptophan synthase subunit beta/LuxR family transcriptional regulator |
| RA | NC_014034 | 1,202,728 | G→A | 100% | intergenic (+588/‑276) | trpB1 → / → RCAP_rcc01130 | tryptophan synthase subunit beta/LuxR family transcriptional regulator |
| RA | NC_014034 | 1,202,744 | G→A | 100% | intergenic (+604/‑260) | trpB1 → / → RCAP_rcc01130 | tryptophan synthase subunit beta/LuxR family transcriptional regulator |
| RA | NC_014034 | 1,230,015 | T→G | 100% | N250K (AAT→AAG) | ccoP → | cbb3‑type cytochrome c oxidase subunit III |
| RA | NC_014034 | 1,239,496 | Δ1 bp | 100% | coding (142/216 nt) | RCAP_rcc01170 ← | hypothetical protein |
| RA | NC_014034 | 1,244,803 | G→T | 100% | A294S (GCC→TCC) | RCAP_rcc01174 → | D‑2‑hydroxyglutarate dehydrogenase |
| RA | NC_014034 | 1,247,167 | G→C | 7.0% | A24A (GCC→GCG) | RCAP_rcc01176 ← | GDSL‑like lipase/acylhydrolase |
| RA | NC_014034 | 1,250,697 | C→G | 100% | G92G (GGG→GGC) | RCAP_rcc01179 ← | transglycosylase, Slt family |
| RA | NC_014034 | 1,251,300 | A→G | 100% | V735A (GTC→GCC) | copA2 ← | copper‑transporting P‑type ATPase |
| RA | NC_014034 | 1,253,265 | Δ1 bp | 9.3% | coding (239/2421 nt) | copA2 ← | copper‑transporting P‑type ATPase |
| RA | NC_014034 | 1,253,890 | +GGGGC | 100% | intergenic (+48/+43) | RCAP_rcc01181 → / ← hisH | hypothetical protein/imidazole glycerol phosphate synthase subunit HisH |
| RA | NC_014034 | 1,253,894 | +CCCC | 100% | intergenic (+52/+39) | RCAP_rcc01181 → / ← hisH | hypothetical protein/imidazole glycerol phosphate synthase subunit HisH |
| RA | NC_014034 | 1,255,865 | +GCCC | 100% | intergenic (+35/+207) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,255,867 | T→C | 100% | intergenic (+37/+205) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,255,868 | +C | 100% | intergenic (+38/+204) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,255,870 | C→T | 100% | intergenic (+40/+202) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,255,899 | 5 bp→5 bp | 100% | intergenic (+69/+169) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,255,904 | +GT | 100% | intergenic (+74/+168) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,255,985 | +G | 2.5% | intergenic (+155/+87) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,256,006 | +G | 100% | intergenic (+176/+66) | RCAP_rcc01184 → / ← RCAP_rcc01185 | CsbD family protein/methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,256,184 | T→G | 100% | K698T (AAG→ACG) | RCAP_rcc01185 ← | methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,258,343 | Δ1 bp | 100% | intergenic (‑67/‑117) | RCAP_rcc01185 ← / → RCAP_rcc01186 | methyl‑accepting chemotaxis sensory transducer/hypothetical protein |
| RA | NC_014034 | 1,258,347 | Δ1 bp | 100% | intergenic (‑71/‑113) | RCAP_rcc01185 ← / → RCAP_rcc01186 | methyl‑accepting chemotaxis sensory transducer/hypothetical protein |
| RA | NC_014034 | 1,259,180 | C→A | 100% | L241M (CTC→ATC) | RCAP_rcc01186 → | hypothetical protein |
| RA | NC_014034 | 1,283,564 | A→G | 100% | T305A (ACG→GCG) | ppdK → | pyruvate, phosphate dikinase |
| RA | NC_014034 | 1,289,811 | T→C | 100% | E34G (GAA→GGA) | RCAP_rcc01213 ← | hypothetical protein |
| RA | NC_014034 | 1,301,058 | G→C | 100% | intergenic (+15/‑94) | urtA → / → urtC | urea ABC transporter permease UrtA/urea ABC transporter permease UrtC |
| RA | NC_014034 | 1,301,060 | +C | 93.6% | intergenic (+17/‑92) | urtA → / → urtC | urea ABC transporter permease UrtA/urea ABC transporter permease UrtC |
| RA | NC_014034 | 1,301,094 | Δ1 bp | 95.1% | intergenic (+51/‑58) | urtA → / → urtC | urea ABC transporter permease UrtA/urea ABC transporter permease UrtC |
| RA | NC_014034 | 1,303,830 | T→C | 100% | intergenic (+17/+140) | urtE → / ← RCAP_rcc01231 | urea ABC transporter ATP‑binding protein UrtE/UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase |
| RA | NC_014034 | 1,303,831 | +CT | 100% | intergenic (+18/+139) | urtE → / ← RCAP_rcc01231 | urea ABC transporter ATP‑binding protein UrtE/UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase |
| RA | NC_014034 | 1,303,918 | +GAAG | 100% | intergenic (+105/+52) | urtE → / ← RCAP_rcc01231 | urea ABC transporter ATP‑binding protein UrtE/UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase |
| RA | NC_014034 | 1,303,926 | T→G | 100% | intergenic (+113/+44) | urtE → / ← RCAP_rcc01231 | urea ABC transporter ATP‑binding protein UrtE/UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase |
| RA | NC_014034 | 1,303,931 | +CA | 100% | intergenic (+118/+39) | urtE → / ← RCAP_rcc01231 | urea ABC transporter ATP‑binding protein UrtE/UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase |
| RA | NC_014034 | 1,303,933 | +G | 100% | intergenic (+120/+37) | urtE → / ← RCAP_rcc01231 | urea ABC transporter ATP‑binding protein UrtE/UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase |
| RA | NC_014034 | 1,311,254 | C→G | 100% | intergenic (‑124/+69) | carA ← / ← RCAP_rcc01239 | carbamoyl‑phosphate synthase small subunit/glyoxalase/bleomycin resistance protein/dioxygenase |
| RA | NC_014034 | 1,311,258 | C→G | 100% | intergenic (‑128/+65) | carA ← / ← RCAP_rcc01239 | carbamoyl‑phosphate synthase small subunit/glyoxalase/bleomycin resistance protein/dioxygenase |
| RA | NC_014034 | 1,316,044 | A→T | 100% | K42M (AAG→ATG) | potA1 → | polyamine ABC transporter ATP binding protein PotA |
| RA | NC_014034 | 1,320,647 | +G | 97.7% | intergenic (+105/+80) | potI1 → / ← RCAP_rcc01247 | polyamine ABC transporter permease PotI/membrane transport family protein |
| RA | NC_014034 | 1,320,651 | +G | 100% | intergenic (+109/+76) | potI1 → / ← RCAP_rcc01247 | polyamine ABC transporter permease PotI/membrane transport family protein |
| RA | NC_014034 | 1,320,707 | +G | 100% | intergenic (+165/+20) | potI1 → / ← RCAP_rcc01247 | polyamine ABC transporter permease PotI/membrane transport family protein |
| RA | NC_014034 | 1,325,125 | G→T | 100% | P351T (CCC→ACC) | dacC2 ← | D‑alanyl‑D‑alanine carboxypeptidase |
| RA | NC_014034 | 1,325,542 | G→C | 100% | P212A (CCG→GCG) | dacC2 ← | D‑alanyl‑D‑alanine carboxypeptidase |
| RA | NC_014034 | 1,388,183 | A→T | 100% | M246F (ATC→TTC) | RCAP_rcc01300 → | Cas3 family CRISPR‑associated helicase |
| RA | NC_014034 | 1,394,037 | T→C | 100% | V59A (GTC→GCC) | RCAP_rcc01305 → | Cas1 family CRISPR‑associated protein |
| RA | NC_014034 | 1,395,397 | Δ1 bp | 4.6% | intergenic (+209/‑722) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,400 | A→T | 4.7% | intergenic (+212/‑719) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,401 | C→G | 4.6% | intergenic (+213/‑718) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,402 | C→G | 4.6% | intergenic (+214/‑717) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,406 | T→G | 4.6% | intergenic (+218/‑713) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,407 | G→C | 4.6% | intergenic (+219/‑712) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,411 | C→G | 4.6% | intergenic (+223/‑708) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,412 | T→C | 4.8% | intergenic (+224/‑707) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,417 | Δ1 bp | 5.6% | intergenic (+229/‑702) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,418 | Δ1 bp | 5.6% | intergenic (+230/‑701) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,423 | G→T | 5.6% | intergenic (+235/‑696) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,424 | G→T | 5.7% | intergenic (+236/‑695) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,426 | +T | 5.7% | intergenic (+238/‑693) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,427 | A→C | 5.7% | intergenic (+239/‑692) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,429 | C→G | 5.9% | intergenic (+241/‑690) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,430 | A→C | 5.2% | intergenic (+242/‑689) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,499 | T→A | 19.6% | intergenic (+311/‑620) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,533 | T→A | 21.4% | intergenic (+345/‑586) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,534 | C→T | 10.0% | intergenic (+346/‑585) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,535 | T→C | 21.5% | intergenic (+347/‑584) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,536 | C→A | 10.9% | intergenic (+348/‑583) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,537 | G→T | 2.4% | intergenic (+349/‑582) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,538 | G→C | 8.6% | intergenic (+350/‑581) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,540 | G→T | 2.3% | intergenic (+352/‑579) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,542 | C→G | 9.8% | intergenic (+354/‑577) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,543 | G→A | 2.3% | intergenic (+355/‑576) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,544 | T→C | 21.9% | intergenic (+356/‑575) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,545 | C→A | 14.7% | intergenic (+357/‑574) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,546 | Δ1 bp | 9.5% | intergenic (+358/‑573) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,547 | C→A | 8.2% | intergenic (+359/‑572) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,549 | C→A | 23.2% | intergenic (+361/‑570) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,550 | G→T | 9.7% | intergenic (+362/‑569) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,550 | +C | 8.2% | intergenic (+362/‑569) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,552 | C→G | 32.0% | intergenic (+364/‑567) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,554 | A→G | 18.7% | intergenic (+366/‑565) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,555 | G→T | 14.3% | intergenic (+367/‑564) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,556 | C→A | 9.2% | intergenic (+368/‑563) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,557 | C→T | 13.6% | intergenic (+369/‑562) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,559 | +A | 22.9% | intergenic (+371/‑560) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,560 | C→A | 14.3% | intergenic (+372/‑559) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,562 | T→C | 21.8% | intergenic (+374/‑557) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,562 | +C | 2.2% | intergenic (+374/‑557) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,564 | C→G | 15.2% | intergenic (+376/‑555) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,565 | T→A | 17.0% | intergenic (+377/‑554) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,566 | C→T | 13.5% | intergenic (+378/‑553) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,666 | T→C | 5.4% | intergenic (+478/‑453) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,668 | T→C | 6.3% | intergenic (+480/‑451) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,669 | G→C | 5.5% | intergenic (+481/‑450) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,670 | C→G | 5.4% | intergenic (+482/‑449) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,672 | T→A | 5.1% | intergenic (+484/‑447) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,673 | G→C | 5.6% | intergenic (+485/‑446) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,674 | T→C | 5.6% | intergenic (+486/‑445) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,675 | A→T | 5.7% | intergenic (+487/‑444) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,683 | +C | 5.6% | intergenic (+495/‑436) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,685 | C→A | 5.4% | intergenic (+497/‑434) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,687 | G→C | 5.3% | intergenic (+499/‑432) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,688 | T→A | 5.4% | intergenic (+500/‑431) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,689 | T→C | 5.6% | intergenic (+501/‑430) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,692 | +T | 5.3% | intergenic (+504/‑427) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,693 | G→A | 5.1% | intergenic (+505/‑426) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,698 | Δ1 bp | 4.7% | intergenic (+510/‑421) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,731 | +C | 15.0% | intergenic (+543/‑388) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,732 | G→T | 6.2% | intergenic (+544/‑387) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,734 | T→C | 16.0% | intergenic (+546/‑385) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,736 | T→A | 14.7% | intergenic (+548/‑383) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,737 | Δ1 bp | 6.2% | intergenic (+549/‑382) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,740 | T→C | 21.3% | intergenic (+552/‑379) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,741 | C→A | 14.8% | intergenic (+553/‑378) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,742 | T→A | 6.3% | intergenic (+554/‑377) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,743 | G→C | 15.0% | intergenic (+555/‑376) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,743 | +A | 6.5% | intergenic (+555/‑376) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,743 | +T | 6.5% | intergenic (+555/‑376) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,744 | G→C | 6.5% | intergenic (+556/‑375) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,746 | G→C | 15.1% | intergenic (+558/‑373) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,747 | C→G | 15.2% | intergenic (+559/‑372) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,749 | A→T | 15.0% | intergenic (+561/‑370) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,750 | A→C | 16.5% | intergenic (+562/‑369) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,751 | C→T | 14.9% | intergenic (+563/‑368) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,753 | +G | 15.6% | intergenic (+565/‑366) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,753 | +T | 15.6% | intergenic (+565/‑366) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,754 | A→C | 6.7% | intergenic (+566/‑365) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,755 | A→C | 6.7% | intergenic (+567/‑364) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,756 | A→G | 21.8% | intergenic (+568/‑363) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,758 | T→C | 16.9% | intergenic (+570/‑361) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,760 | T→G | 15.7% | intergenic (+572/‑359) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,760 | +C | 7.1% | intergenic (+572/‑359) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,761 | +A | 7.1% | intergenic (+573/‑358) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,763 | C→G | 16.8% | intergenic (+575/‑356) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,800 | +T | 1.4% | intergenic (+612/‑319) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,864 | T→C | 5.9% | intergenic (+676/‑255) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,865 | G→C | 6.3% | intergenic (+677/‑254) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,866 | C→T | 19.0% | intergenic (+678/‑253) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,867 | +T | 1.0% | intergenic (+679/‑252) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,869 | C→G | 6.3% | intergenic (+681/‑250) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,871 | C→G | 19.0% | intergenic (+683/‑248) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,872 | C→T | 19.8% | intergenic (+684/‑247) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,874 | A→C | 24.3% | intergenic (+686/‑245) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,875 | T→C | 25.0% | intergenic (+687/‑244) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,878 | C→G | 19.9% | intergenic (+690/‑241) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,880 | T→G | 25.6% | intergenic (+692/‑239) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,881 | C→A | 26.0% | intergenic (+693/‑238) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,884 | G→C | 20.0% | intergenic (+696/‑235) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,884 | +T | 6.7% | intergenic (+696/‑235) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,884 | +C | 6.7% | intergenic (+696/‑235) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,884 | +T | 6.7% | intergenic (+696/‑235) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,886 | C→G | 19.5% | intergenic (+698/‑233) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,887 | G→T | 6.6% | intergenic (+699/‑232) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,890 | C→T | 7.3% | intergenic (+702/‑229) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,891 | Δ1 bp | 21.1% | intergenic (+703/‑228) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,893 | +A | 1.1% | intergenic (+705/‑226) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,894 | G→T | 22.2% | intergenic (+706/‑225) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,896 | G→T | 7.1% | intergenic (+708/‑223) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,896 | +A | 1.1% | intergenic (+708/‑223) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,897 | C→G | 8.2% | intergenic (+709/‑222) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,898 | A→C | 8.4% | intergenic (+710/‑221) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,898 | +C | 20.7% | intergenic (+710/‑221) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,931 | G→A | 12.1% | intergenic (+743/‑188) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,936 | G→T | 3.5% | intergenic (+748/‑183) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,937 | T→G | 3.5% | intergenic (+749/‑182) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,938 | T→G | 3.4% | intergenic (+750/‑181) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,940 | A→T | 3.4% | intergenic (+752/‑179) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,941 | T→C | 3.5% | intergenic (+753/‑178) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,943 | G→A | 3.5% | intergenic (+755/‑176) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,946 | T→G | 3.6% | intergenic (+758/‑173) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,948 | C→G | 3.6% | intergenic (+760/‑171) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,949 | G→T | 3.1% | intergenic (+761/‑170) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,952 | G→A | 3.7% | intergenic (+764/‑167) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,953 | G→C | 3.7% | intergenic (+765/‑166) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,955 | C→G | 3.1% | intergenic (+767/‑164) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,956 | A→C | 3.1% | intergenic (+768/‑163) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,958 | T→G | 3.2% | intergenic (+770/‑161) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,960 | G→C | 3.1% | intergenic (+772/‑159) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,961 | A→T | 3.1% | intergenic (+773/‑158) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,962 | C→A | 3.1% | intergenic (+774/‑157) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,395,964 | G→C | 3.0% | intergenic (+776/‑155) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,000 | C→G | 20.1% | intergenic (+812/‑119) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,011 | Δ1 bp | 21.2% | intergenic (+823/‑108) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,014 | T→C | 21.0% | intergenic (+826/‑105) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,015 | T→A | 21.0% | intergenic (+827/‑104) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,022 | C→G | 21.6% | intergenic (+834/‑97) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,023 | G→T | 21.1% | intergenic (+835/‑96) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,024 | C→A | 21.0% | intergenic (+836/‑95) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,025 | C→T | 20.9% | intergenic (+837/‑94) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,028 | +G | 20.9% | intergenic (+840/‑91) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,031 | +T | 20.6% | intergenic (+843/‑88) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,031 | +G | 20.6% | intergenic (+843/‑88) | RCAP_rcc01306 → / → RCAP_rcc01307 | Cas2 family CRISPR‑associated protein/hypothetical protein |
| RA | NC_014034 | 1,396,132 | T→C | 4.6% | F5S (TTT→TCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,133 | T→G | 4.1% | F5L (TTT→TCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,134 | T→G | 4.5% | S6A (TCG→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,136 | G→C | 4.5% | S6S (TCG→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,138 | +G | 4.4% | coding (20/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,142 | T→C | 4.3% | S8S (TCT→TCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,144 | +T | 4.3% | coding (26/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,148 | G→C | 4.0% | R10S (AGG→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,153 | C→T | 5.2% | A12V (GCG→GTA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,154 | G→A | 5.3% | A12A (GCG→GTA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,155 | C→T | 5.3% | P13S (CCG→TTG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,156 | C→T | 5.9% | P13L (CCG→TTG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,158 | Δ1 bp | 5.4% | coding (40/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,160 | A→G | 5.2% | P14P (CCA→CCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,166 | Δ1 bp | 4.8% | coding (48/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,471 | G→C | 3.8% | G118A (GGA→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,472 | A→T | 3.8% | G118G (GGA→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,473 | C→G | 3.9% | P119A (CCT→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,478 | A→C | 3.8% | E120D (GAA→GAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,480 | Δ1 bp | 3.8% | coding (362/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,481 | Δ1 bp | 3.8% | coding (363/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,486 | G→C | 4.1% | R123P (CGG→CCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,487 | G→A | 3.9% | R123R (CGG→CCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,488 | G→A | 3.9% | E124K (GAA→ACA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,489 | A→C | 4.2% | E124A (GAA→ACA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,492 | C→A | 4.3% | T125K (ACG→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,493 | G→T | 4.6% | T125T (ACG→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,494 | C→A | 4.5% | R126R (CGG→ATG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,495 | G→T | 4.6% | R126L (CGG→ATG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,497 | C→T | 4.5% | R127W (CGG→TGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,500 | C→T | 4.5% | R128* (CGA→TCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,501 | G→C | 4.5% | R128P (CGA→TCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,503 | G→A | 4.3% | A129T (GCA→ACA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,506 | +T | 4.5% | coding (388/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,539 | T→A | 17.3% | C141S (TGC→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,552 | C→G | 16.7% | T145S (ACT→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,553 | T→C | 16.7% | T145T (ACT→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,556 | C→G | 17.1% | G146G (GGC→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,558 | A→G | 17.2% | Q147R (CAG→CGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,559 | G→C | 17.7% | Q147H (CAG→CGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,561 | C→G | 18.4% | P148R (CCG→CGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,563 | C→G | 18.6% | P149A (CCC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,566 | G→A | 18.9% | A150T (GCG→AAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,567 | C→A | 19.0% | A150E (GCG→AAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,568 | G→C | 18.4% | A150A (GCG→AAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,570 | C→T | 18.0% | P151L (CCA→CTA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,572 | A→T | 17.8% | S152C (AGT→TGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,580 | C→A | 18.2% | S154S (TCC→TCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,803 | C→G | 13.9% | R229G (CGT→GGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,805 | T→C | 14.1% | R229R (CGT→GGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,808 | G→A | 14.2% | V230V (GTG→GTA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,811 | +C | 14.4% | coding (693/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,811 | +T | 14.4% | coding (693/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,811 | +C | 14.4% | coding (693/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,813 | A→G | 14.4% | D232G (GAT→GGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,816 | A→T | 13.6% | H233L (CAT→CTG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,817 | T→G | 14.0% | H233Q (CAT→CTG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,819 | C→G | 13.7% | A234G (GCA→GGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,820 | A→T | 13.3% | A234A (GCA→GGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,825 | G→T | 14.2% | R236L (CGG→CTC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,826 | G→C | 14.2% | R236R (CGG→CTC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,827 | A→G | 14.2% | T237A (ACG→GCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,831 | Δ1 bp | 13.8% | coding (713/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,835 | G→C | 14.1% | W239C (TGG→TGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,935 | Δ1 bp | 12.1% | coding (817/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,936 | Δ1 bp | 10.7% | coding (818/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,937 | C→A | 12.1% | S273R (AGC→AGA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,938 | C→T | 13.2% | M274M (CTG→TGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,939 | T→G | 12.5% | L274R (CTG→TGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,940 | G→T | 10.1% | L274L (CTG→TGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,941 | C→A | 12.5% | R275S (CGC→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,944 | Δ1 bp | 10.9% | coding (826/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,944 | +C | 12.3% | coding (826/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,945 | G→C | 11.9% | G276A (GGC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,946 | +A | 10.6% | coding (828/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,947 | C→T | 12.0% | R277C (CGC→TGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,950 | A→G | 21.5% | M278V (ATC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,951 | T→C | 15.6% | I278T (ATC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,953 | G→A | 20.0% | G279S (GGC→ATA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,954 | G→T | 10.4% | G279V (GGC→ATA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,955 | C→A | 13.5% | G279G (GGC→ATA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,956 | T→G | 11.3% | F280V (TTC→GAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,956 | +C | 11.9% | coding (838/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,957 | T→A | 10.3% | F280Y (TTC→GAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,958 | C→T | 16.5% | F280F (TTC→GAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,959 | C→T | 32.0% | R281C (CGC→TGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,961 | C→T | 12.1% | R281R (CGC→TGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,961 | +G | 10.5% | coding (843/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,964 | G→T | 10.7% | L282L (CTG→CTT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,964 | +G | 10.8% | coding (846/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,964 | +A | 10.8% | coding (846/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,968 | G→C | 9.7% | G284R (GGT→CGT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,396,968 | +C | 10.8% | coding (850/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,031 | T→G | 23.1% | S305A (TCC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,132 | G→A | 5.2% | T338T (ACG→ACA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,133 | T→A | 5.2% | S339T (TCC→AAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,134 | C→A | 5.3% | S339Y (TCC→AAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,135 | C→A | 5.3% | S339S (TCC→AAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,139 | T→C | 5.5% | S341P (TCG→CGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,140 | C→G | 5.6% | S341W (TCG→CGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,141 | G→C | 5.6% | S341S (TCG→CGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,144 | C→A | 5.6% | R342R (CGC→CGA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,147 | C→A | 5.8% | H343Q (CAC→CAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,149 | T→C | 5.3% | M344T (ATG→ACG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,151 | Δ1 bp | 5.6% | coding (1033/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,153 | T→G | 5.8% | S345S (TCT→TCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,154 | T→G | 5.8% | S346A (TCG→GCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,156 | G→A | 6.1% | S346S (TCG→GCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,159 | +G | 6.4% | coding (1041/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,161 | T→C | 6.6% | V348A (GTG→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,162 | G→C | 6.4% | V348V (GTG→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,165 | C→G | 6.3% | R349R (CGC→CGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,200 | T→C | 4.3% | V361A (GTG→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,201 | G→T | 4.0% | V361V (GTG→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,202 | T→G | 4.0% | S362A (TCT→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,206 | C→A | 4.1% | A363D (GCC→GAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,208 | +C | 4.3% | coding (1090/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,211 | A→C | 4.0% | T365P (ACG→CCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,213 | G→A | 3.8% | T365T (ACG→CCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,216 | C→A | 3.7% | P366P (CCC→CCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,217 | T→A | 3.8% | C367S (TGC→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,218 | G→A | 3.7% | C367Y (TGC→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,219 | C→T | 3.7% | C367C (TGC→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,221 | C→T | 3.8% | T368I (ACC→ATG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,222 | C→G | 4.2% | T368T (ACC→ATG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,223 | A→T | 4.3% | R369* (AGA→TGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,225 | A→G | 3.8% | R369R (AGA→TGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,228 | C→A | 4.0% | S370S (TCC→TCA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,229 | G→A | 4.1% | A371T (GCG→ACA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,231 | G→A | 4.1% | A371A (GCG→ACA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,233 | C→T | 4.5% | P372L (CCG→CTG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,267 | C→A | 3.0% | H383Q (CAC→CAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,268 | C→T | 2.9% | R384C (CGC→TGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,270 | +G | 3.0% | coding (1152/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,273 | A→G | 3.4% | A385A (GCA→GCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,276 | C→G | 3.0% | R386R (CGC→CGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,279 | G→C | 3.6% | A387A (GCG→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,280 | A→T | 3.1% | N388Y (AAC→TAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,282 | C→T | 3.1% | N388N (AAC→TAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,285 | +T | 3.2% | coding (1167/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,287 | T→A | 3.3% | V390D (GTC→GAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,289 | A→G | 3.3% | S391G (AGC→GGA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,291 | C→A | 3.5% | S391R (AGC→GGA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,297 | Δ1 bp | 3.6% | coding (1179/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,298 | Δ1 bp | 3.3% | coding (1180/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,299 | A→C | 3.9% | N394T (AAC→ACC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,318 | A→G | 4.7% | G400G (GGA→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,467 | C→T | 18.3% | T450I (ACC→ATC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,469 | +A | 18.9% | coding (1351/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,471 | C→G | 18.6% | V451V (GTC→GTG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,476 | C→A | 18.3% | T453N (ACC→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,477 | C→T | 18.3% | T453T (ACC→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,478 | A→C | 18.2% | T454P (ACG→CCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,483 | +T | 17.8% | coding (1365/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,485 | C→G | 17.6% | P456R (CCG→CGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,489 | C→G | 18.4% | P457P (CCC→CCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,490 | T→G | 18.9% | C458G (TGC→GGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,493 | A→T | 20.5% | T459S (ACC→TCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,495 | C→G | 20.5% | T459T (ACC→TCG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,497 | C→T | 20.4% | T460I (ACC→ATC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,499 | Δ1 bp | 18.6% | coding (1381/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,532 | A→T | 8.5% | N472Y (AAC→TAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,534 | C→T | 6.7% | N472N (AAC→TAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,535 | C→A | 14.8% | P473T (CCG→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,536 | C→A | 11.7% | P473Q (CCG→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,537 | G→T | 17.6% | P473P (CCG→AAT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,538 | A→G | 17.7% | M474V (ATC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,539 | T→C | 18.7% | I474T (ATC→GCC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,541 | A→G | 14.3% | M475M (ATG→GAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,542 | T→A | 11.6% | M475K (ATG→GAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,543 | G→A | 11.9% | M475I (ATG→GAA) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,544 | G→T | 9.3% | A476S (GCC→TAG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,545 | C→A | 6.0% | A476D (GCC→TAG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,545 | +G | 9.1% | coding (1427/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,546 | C→G | 9.0% | A476A (GCC→TAG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,546 | +A | 11.2% | coding (1428/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,546 | +A | 11.2% | coding (1428/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,547 | C→G | 11.2% | R477G (CGC→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,549 | C→G | 9.4% | R477R (CGC→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,550 | C→G | 6.2% | L478V (CTC→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,551 | T→G | 12.6% | L478R (CTC→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,552 | C→G | 10.2% | L478L (CTC→GGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,553 | A→C | 8.3% | S479R (AGC→CAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,554 | G→A | 15.6% | S479N (AGC→CAC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,555 | Δ1 bp | 2.2% | coding (1437/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,556 | G→A | 21.0% | A480T (GCC→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,557 | C→G | 18.0% | A480G (GCC→AGC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,560 | Δ1 bp | 11.9% | coding (1442/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,561 | G→T | 9.3% | A481A (GCG→GCT) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,562 | C→A | 9.2% | M482M (CTG→ACC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,563 | T→C | 9.1% | L482P (CTG→ACC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,563 | +C | 2.2% | coding (1445/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,564 | G→C | 9.8% | L482L (CTG→ACC) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,565 | A→C | 13.2% | T483P (ACG→CGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,565 | +T | 2.2% | coding (1447/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,566 | C→G | 10.8% | T483R (ACG→CGG) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,674 | +T | 1.1% | coding (1556/1578 nt) | RCAP_rcc01307 → | hypothetical protein |
| RA | NC_014034 | 1,397,717 | C→G | 100% | intergenic (+21/+1877) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,867 | +A | 1.9% | intergenic (+171/+1727) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,870 | G→A | 1.9% | intergenic (+174/+1724) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,871 | G→A | 2.1% | intergenic (+175/+1723) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,872 | C→T | 1.9% | intergenic (+176/+1722) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,873 | A→G | 1.9% | intergenic (+177/+1721) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,876 | T→G | 1.8% | intergenic (+180/+1718) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,877 | C→A | 1.8% | intergenic (+181/+1717) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,882 | C→A | 2.3% | intergenic (+186/+1712) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,883 | C→A | 2.0% | intergenic (+187/+1711) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,885 | C→G | 2.0% | intergenic (+189/+1709) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,890 | T→A | 1.9% | intergenic (+194/+1704) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,892 | T→C | 2.0% | intergenic (+196/+1702) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,893 | C→A | 2.0% | intergenic (+197/+1701) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,894 | T→G | 2.0% | intergenic (+198/+1700) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,896 | A→G | 1.9% | intergenic (+200/+1698) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,897 | C→G | 1.9% | intergenic (+201/+1697) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,899 | A→T | 2.0% | intergenic (+203/+1695) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,900 | A→G | 2.0% | intergenic (+204/+1694) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,397,902 | A→G | 2.0% | intergenic (+206/+1692) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,398,314 | A→G | 100% | intergenic (+618/+1280) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,398,422 | C→G | 100% | intergenic (+726/+1172) | RCAP_rcc01307 → / ← RCAP_rcc01309 | hypothetical protein/IS66 family transposase |
| RA | NC_014034 | 1,404,504 | G→C | 100% | M65I (ATG→ATC) | RCAP_rcc01314 → | hypothetical protein |
| RA | NC_014034 | 1,412,637 | T→C | 100% | S398G (AGC→GGC) | RCAP_rcc01318 ← | outer membrane autotransporter barrel domain‑containing protein |
| RA | NC_014034 | 1,412,658 | G→A | 100% | H391Y (CAT→TAT) | RCAP_rcc01318 ← | outer membrane autotransporter barrel domain‑containing protein |
| RA | NC_014034 | 1,417,281 | C→T | 100% | P46L (CCC→CTC) | RCAP_rcc01321 → | GNAT family acetyltransferase |
| RA | NC_014034 | 1,428,375 | G→A | 100% | intergenic (+14/‑512) | RCAP_rcc01327 → / → RCAP_rcc01328 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 1,434,381 | +G | 11.0% | intergenic (‑160/‑798) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,381 | +G | 11.0% | intergenic (‑160/‑798) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,385 | T→G | 11.4% | intergenic (‑164/‑794) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,386 | C→A | 11.3% | intergenic (‑165/‑793) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,387 | C→A | 11.7% | intergenic (‑166/‑792) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,389 | C→A | 13.1% | intergenic (‑168/‑790) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,390 | T→C | 13.2% | intergenic (‑169/‑789) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,397 | C→G | 11.2% | intergenic (‑176/‑782) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,400 | G→A | 1.7% | intergenic (‑179/‑779) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,400 | +C | 11.3% | intergenic (‑179/‑779) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,403 | Δ1 bp | 1.4% | intergenic (‑182/‑776) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,405 | C→G | 11.6% | intergenic (‑184/‑774) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,406 | G→A | 11.3% | intergenic (‑185/‑773) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,409 | A→T | 11.3% | intergenic (‑188/‑770) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,410 | A→G | 11.6% | intergenic (‑189/‑769) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,412 | C→G | 11.6% | intergenic (‑191/‑767) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,413 | T→G | 11.6% | intergenic (‑192/‑766) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,414 | T→C | 11.6% | intergenic (‑193/‑765) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,414 | +C | 1.5% | intergenic (‑193/‑765) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,434,414 | +A | 1.5% | intergenic (‑193/‑765) | RCAP_rcc01334 ← / → RCAP_rcc01335 | hypothetical protein/Fis family GAF modulated sigma54 specific transcriptional regulator |
| RA | NC_014034 | 1,443,757 | G→C | 100% | D40E (GAC→GAG) | RCAP_rcc01340 ← | LysR family transcriptional regulator |
| RA | NC_014034 | 1,443,778 | G→C | 100% | A33A (GCC→GCG) | RCAP_rcc01340 ← | LysR family transcriptional regulator |
| RA | NC_014034 | 1,446,527 | C→T | 11.8% | A142A (GCC→GCT) | RCAP_rcc01343 → | iron siderophore/cobalamin ABC transporter permease |
| RA | NC_014034 | 1,462,868 | C→A | 100% | M313M (GTG→TTG) | RCAP_rcc01360 ← | adenylate/guanylate cyclase/CHASE2 sensor domain‑containing protein |
| RA | NC_014034 | 1,468,465 | C→G | 100% | G457A (GGC→GCC) | RCAP_rcc01364 ← | signal transduction histidine kinase |
| RA | NC_014034 | 1,478,626 | G→C | 100% | intergenic (+114/+29) | RCAP_rcc01372 → / ← RCAP_rcc01373 | ABC transporter ATP‑binding protein/RpiR family transcriptional regulator |
| RA | NC_014034 | 1,478,631 | +G | 100% | intergenic (+119/+24) | RCAP_rcc01372 → / ← RCAP_rcc01373 | ABC transporter ATP‑binding protein/RpiR family transcriptional regulator |
| RA | NC_014034 | 1,491,761 | C→G | 100% | G723R (GGG→CGG) | uvrB ← | UvrABC system protein B |
| RA | NC_014034 | 1,493,107 | C→G | 100% | R274P (CGC→CCC) | uvrB ← | UvrABC system protein B |
| RA | NC_014034 | 1,495,792 | C→G | 100% | M65M (GTG→CTG) | RCAP_rcc01387 ← | RpiR family transcriptional regulator |
| RA | NC_014034 | 1,507,982 | G→C | 100% | R80R (CGG→CGC) | RCAP_rcc01400 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,521,804 | T→A | 100% | H698L (CAC→CTC) | RCAP_rcc01410 ← | hypothetical protein |
| RA | NC_014034 | 1,575,638 | 5 bp→5 bp | 100% | intergenic (+40/+129) | corA → / ← RCAP_rcc01455 | magnesium/cobalt transport protein CorA/hypothetical protein |
| RA | NC_014034 | 1,575,644 | +C | 100% | intergenic (+46/+127) | corA → / ← RCAP_rcc01455 | magnesium/cobalt transport protein CorA/hypothetical protein |
| RA | NC_014034 | 1,575,647 | G→C | 100% | intergenic (+49/+124) | corA → / ← RCAP_rcc01455 | magnesium/cobalt transport protein CorA/hypothetical protein |
| RA | NC_014034 | 1,575,649 | G→C | 100% | intergenic (+51/+122) | corA → / ← RCAP_rcc01455 | magnesium/cobalt transport protein CorA/hypothetical protein |
| RA | NC_014034 | 1,578,102 | T→G | 100% | N96K (AAT→AAG) | tatB → | Sec‑independent protein translocase TatB |
| RA | NC_014034 | 1,606,281 | +T | 1.5% | coding (13/1083 nt) | mraY → | phospho‑N‑acetylmuramoyl‑pentapeptide‑ transferase |
| RA | NC_014034 | 1,607,903 | Δ1 bp | 100% | intergenic (+173/‑174) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,607,916 | Δ1 bp | 100% | intergenic (+186/‑161) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,607,927 | Δ1 bp | 100% | intergenic (+197/‑150) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,607,933 | G→C | 100% | intergenic (+203/‑144) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,607,942 | Δ1 bp | 100% | intergenic (+212/‑135) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,607,985 | Δ1 bp | 100% | intergenic (+255/‑92) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,608,028 | G→T | 100% | intergenic (+298/‑49) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,608,033 | 2 bp→T | 100% | intergenic (+303/‑43) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,608,040 | Δ1 bp | 87.9% | intergenic (+310/‑37) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,608,042 | G→C | 12.1% | intergenic (+312/‑35) | RCAP_rcc01484 → / → murD | hypothetical protein/UDP‑N‑acetylmuramoylalanine‑‑D‑glutamate ligase |
| RA | NC_014034 | 1,639,586 | +G | 2.9% | coding (1271/1605 nt) | mccB → | methylcrotonoyl‑CoA carboxylase subunit beta |
| RA | NC_014034 | 1,640,005 | +G | 95.8% | intergenic (+85/‑60) | mccB → / → mccA | methylcrotonoyl‑CoA carboxylase subunit beta/methylcrotonoyl‑CoA carboxylase subunit alpha |
| RA | NC_014034 | 1,640,005 | +G | 95.8% | intergenic (+85/‑60) | mccB → / → mccA | methylcrotonoyl‑CoA carboxylase subunit beta/methylcrotonoyl‑CoA carboxylase subunit alpha |
| RA | NC_014034 | 1,640,005 | +C | 95.8% | intergenic (+85/‑60) | mccB → / → mccA | methylcrotonoyl‑CoA carboxylase subunit beta/methylcrotonoyl‑CoA carboxylase subunit alpha |
| RA | NC_014034 | 1,640,005 | +A | 95.8% | intergenic (+85/‑60) | mccB → / → mccA | methylcrotonoyl‑CoA carboxylase subunit beta/methylcrotonoyl‑CoA carboxylase subunit alpha |
| RA | NC_014034 | 1,644,608 | C→G | 100% | A27G (GCA→GGA) | nuoA → | NADH‑quinone oxidoreductase subunit A |
| RA | NC_014034 | 1,644,622 | C→G | 100% | P32A (CCC→GCC) | nuoA → | NADH‑quinone oxidoreductase subunit A |
| RA | NC_014034 | 1,644,625 | C→G | 100% | P33A (CCC→GCC) | nuoA → | NADH‑quinone oxidoreductase subunit A |
| RA | NC_014034 | 1,644,711 | A→G | 100% | R61R (CGA→CGG) | nuoA → | NADH‑quinone oxidoreductase subunit A |
| RA | NC_014034 | 1,644,761 | C→T | 100% | S78F (TCC→TTC) | nuoA → | NADH‑quinone oxidoreductase subunit A |
| RA | NC_014034 | 1,650,522 | C→G | 100% | A429A (GCC→GCG) | nuoF → | NADH‑quinone oxidoreductase subunit F |
| RA | NC_014034 | 1,654,067 | C→G | 100% | P648A (CCG→GCG) | nuoG → | NADH‑quinone oxidoreductase subunit G |
| RA | NC_014034 | 1,659,074 | A→G | 100% | G442G (GGA→GGG) | nuoL → | NADH‑quinone oxidoreductase subunit L |
| RA | NC_014034 | 1,668,398 | Δ2 bp | 100% | intergenic (‑63/+18) | ilvH ← / ← ilvI | acetolactate synthase small subunit/acetolactate synthase large subunit |
| RA | NC_014034 | 1,668,401 | G→C | 100% | intergenic (‑66/+16) | ilvH ← / ← ilvI | acetolactate synthase small subunit/acetolactate synthase large subunit |
| RA | NC_014034 | 1,668,733 | C→T | 100% | S477N (AGC→AAC) | ilvI ← | acetolactate synthase large subunit |
| RA | NC_014034 | 1,668,994 | C→T | 100% | S390N (AGC→AAC) | ilvI ← | acetolactate synthase large subunit |
| RA | NC_014034 | 1,669,016 | T→C | 100% | K383E (AAG→GAG) | ilvI ← | acetolactate synthase large subunit |
| RA | NC_014034 | 1,669,045 | G→A | 100% | T373I (ACC→ATC) | ilvI ← | acetolactate synthase large subunit |
| RA | NC_014034 | 1,675,929 | A→G | 100% | R198R (CGA→CGG) | prfB → | peptide chain release factor 2 |
| RA | NC_014034 | 1,675,931 | A→T | 100% | Q199L (CAG→CTG) | prfB → | peptide chain release factor 2 |
| RA | NC_014034 | 1,684,192 | A→T | 100% | intergenic (+18/‑7) | queA → / → RCAP_rcc01554 | S‑adenosylmethionine:tRNA ribosyltransferase‑isomerase/major facilitator superfamily protein |
| RA | NC_014034 | 1,696,149 | A→G | 100% | intergenic (‑77/+148) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,154 | Δ1 bp | 100% | intergenic (‑82/+143) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,157 | Δ1 bp | 100% | intergenic (‑85/+140) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,166 | A→C | 100% | intergenic (‑94/+131) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,177 | +C | 95.1% | intergenic (‑105/+120) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,179 | A→C | 4.2% | intergenic (‑107/+118) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,181 | T→A | 3.8% | intergenic (‑109/+116) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,183 | C→T | 3.9% | intergenic (‑111/+114) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,184 | C→A | 96.1% | intergenic (‑112/+113) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,185 | A→C | 100% | intergenic (‑113/+112) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,193 | A→T | 100% | intergenic (‑121/+104) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,195 | G→T | 100% | intergenic (‑123/+102) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,205 | Δ1 bp | 97.1% | intergenic (‑133/+92) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,206 | Δ1 bp | 98.4% | intergenic (‑134/+91) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,214 | Δ1 bp | 100% | intergenic (‑142/+83) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,696,217 | Δ1 bp | 86.4% | intergenic (‑145/+80) | RCAP_rcc01564 ← / ← mmsA | isobutyryl‑CoA dehydrogenase/methylmalonate‑semialdehyde dehydrogenase |
| RA | NC_014034 | 1,699,947 | +G | 13.9% | intergenic (+20/+23) | RCAP_rcc01568 → / ← purF | RES domain family protein/amidophosphoribosyltransferase |
| RA | NC_014034 | 1,699,949 | G→C | 16.5% | intergenic (+22/+21) | RCAP_rcc01568 → / ← purF | RES domain family protein/amidophosphoribosyltransferase |
| RA | NC_014034 | 1,699,950 | C→A | 15.6% | intergenic (+23/+20) | RCAP_rcc01568 → / ← purF | RES domain family protein/amidophosphoribosyltransferase |
| RA | NC_014034 | 1,699,950 | +A | 6.5% | intergenic (+23/+20) | RCAP_rcc01568 → / ← purF | RES domain family protein/amidophosphoribosyltransferase |
| RA | NC_014034 | 1,721,519 | +GG | 100% | intergenic (‑414/+32) | RCAP_rcc01588 ← / ← RCAP_rcc01589 | GSCFA family protein/ErfK/YbiS/YcfS/YnhG family protein |
| RA | NC_014034 | 1,729,654 | +C | 100% | intergenic (+28/+125) | RCAP_rcc01597 → / ← tpiA | AsnC/Lrp family transcriptional regulator/triose‑phosphate isomerase |
| RA | NC_014034 | 1,732,696 | +C | 92.0% | intergenic (‑120/‑283) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,702 | +GG | 100% | intergenic (‑126/‑277) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,707 | 3 bp→TCC | 100% | intergenic (‑131/‑270) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,849 | C→G | 22.1% | intergenic (‑273/‑130) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,860 | G→C | 17.3% | intergenic (‑284/‑119) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,866 | +GCG | 100% | intergenic (‑290/‑113) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,868 | T→C | 11.4% | intergenic (‑292/‑111) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,732,869 | C→G | 12.5% | intergenic (‑293/‑110) | RCAP_rcc01601 ← / → tgt | FeS assembly SUF system protein/queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,733,287 | 2 bp→GC | 100% | coding (309‑310/1128 nt) | tgt → | queuine tRNA‑ribosyltransferase |
| RA | NC_014034 | 1,734,841 | +C | 97.9% | intergenic (‑94/+99) | RCAP_rcc01603 ← / ← RCAP_rcc01604 | hemolysin‑III family protein/hypothetical protein |
| RA | NC_014034 | 1,734,891 | +A | 1.4% | intergenic (‑144/+49) | RCAP_rcc01603 ← / ← RCAP_rcc01604 | hemolysin‑III family protein/hypothetical protein |
| RA | NC_014034 | 1,734,917 | +A | 1.4% | intergenic (‑170/+23) | RCAP_rcc01603 ← / ← RCAP_rcc01604 | hemolysin‑III family protein/hypothetical protein |
| RA | NC_014034 | 1,737,122 | +A | 1.9% | intergenic (+63/‑228) | RCAP_rcc01606 → / → RCAP_rcc01607 | tRNA/rRNA methyltransferase, SpoU family/hypothetical protein |
| RA | NC_014034 | 1,740,767 | +G | 2.0% | intergenic (+4/+131) | cxp → / ← RCAP_rcc01610 | thermostable carboxypeptidase 1/hypothetical protein |
| RA | NC_014034 | 1,740,769 | +G | 100% | intergenic (+6/+129) | cxp → / ← RCAP_rcc01610 | thermostable carboxypeptidase 1/hypothetical protein |
| RA | NC_014034 | 1,740,784 | C→G | 100% | intergenic (+21/+114) | cxp → / ← RCAP_rcc01610 | thermostable carboxypeptidase 1/hypothetical protein |
| RA | NC_014034 | 1,740,785 | +C | 1.9% | intergenic (+22/+113) | cxp → / ← RCAP_rcc01610 | thermostable carboxypeptidase 1/hypothetical protein |
| RA | NC_014034 | 1,740,893 | +C | 97.9% | intergenic (+130/+5) | cxp → / ← RCAP_rcc01610 | thermostable carboxypeptidase 1/hypothetical protein |
| RA | NC_014034 | 1,742,045 | 2 bp→CG | 100% | coding (67‑68/1215 nt) | RCAP_rcc01610 ← | hypothetical protein |
| RA | NC_014034 | 1,745,340 | Δ1 bp | 100% | coding (1/1203 nt) | RCAP_rcc01613 ← | hypothetical protein |
| RA | NC_014034 | 1,745,346 | Δ1 bp | 100% | intergenic (‑6/+762) | RCAP_rcc01613 ← / ← metH4 | hypothetical protein/methionine synthase subunit B |
| RA | NC_014034 | 1,745,434 | +C | 100% | intergenic (‑94/+674) | RCAP_rcc01613 ← / ← metH4 | hypothetical protein/methionine synthase subunit B |
| RA | NC_014034 | 1,745,443 | Δ1 bp | 100% | intergenic (‑103/+665) | RCAP_rcc01613 ← / ← metH4 | hypothetical protein/methionine synthase subunit B |
| RA | NC_014034 | 1,745,454 | +C | 100% | intergenic (‑114/+654) | RCAP_rcc01613 ← / ← metH4 | hypothetical protein/methionine synthase subunit B |
| RA | NC_014034 | 1,751,385 | C→G | 100% | A230G (GCG→GGG) | RCAP_rcc01619 → | Fis family transcriptional regulator |
| RA | NC_014034 | 1,751,689 | +C | 100% | intergenic (+18/‑340) | RCAP_rcc01619 → / → aldB | Fis family transcriptional regulator/aldehyde dehydrogenase |
| RA | NC_014034 | 1,751,825 | 2 bp→GC | 100% | intergenic (+154/‑203) | RCAP_rcc01619 → / → aldB | Fis family transcriptional regulator/aldehyde dehydrogenase |
| RA | NC_014034 | 1,756,589 | +C | 100% | coding (927/945 nt) | RCAP_rcc01623 ← | AraC family transcriptional regulator |
| RA | NC_014034 | 1,756,670 | +G | 100% | coding (846/945 nt) | RCAP_rcc01623 ← | AraC family transcriptional regulator |
| RA | NC_014034 | 1,761,369 | A→T | 100% | T200S (ACG→TCG) | cdsA1 → | phosphatidate cytidylyltransferase |
| RA | NC_014034 | 1,763,082 | +C | 100% | coding (337/1338 nt) | RCAP_rcc01630 → | M50 family peptidase |
| RA | NC_014034 | 1,763,083 | +C | 100% | coding (338/1338 nt) | RCAP_rcc01630 → | M50 family peptidase |
| RA | NC_014034 | 1,763,097 | G→T | 100% | G118C (GGC→TGC) | RCAP_rcc01630 → | M50 family peptidase |
| RA | NC_014034 | 1,763,106 | +C | 100% | coding (361/1338 nt) | RCAP_rcc01630 → | M50 family peptidase |
| RA | NC_014034 | 1,766,899 | A→C | 100% | intergenic (+25/‑36) | yaeT → / → RCAP_rcc01633 | outer membrane protein assembly factor YaeT/outer membrane chaperone Skp family protein |
| RA | NC_014034 | 1,766,903 | +C | 100% | intergenic (+29/‑32) | yaeT → / → RCAP_rcc01633 | outer membrane protein assembly factor YaeT/outer membrane chaperone Skp family protein |
| RA | NC_014034 | 1,768,902 | +G | 97.7% | intergenic (+29/‑27) | lpxA → / → RCAP_rcc01636 | acyl‑ACP‑‑UDP‑N‑acetylglucosamine O‑acyltransferase/hypothetical protein |
| RA | NC_014034 | 1,769,354 | +G | 100% | coding (426/744 nt) | RCAP_rcc01636 → | hypothetical protein |
| RA | NC_014034 | 1,769,358 | +G | 100% | coding (430/744 nt) | RCAP_rcc01636 → | hypothetical protein |
| RA | NC_014034 | 1,769,370 | +G | 90.3% | coding (442/744 nt) | RCAP_rcc01636 → | hypothetical protein |
| RA | NC_014034 | 1,769,372 | C→G | 90.4% | P148P (CCC→CCG) | RCAP_rcc01636 → | hypothetical protein |
| RA | NC_014034 | 1,769,374 | C→G | 94.5% | P149R (CCC→CGC) | RCAP_rcc01636 → | hypothetical protein |
| RA | NC_014034 | 1,770,645 | G→C | 100% | R326P (CGG→CCG) | lpxB → | lipid‑A‑disaccharide synthase |
| RA | NC_014034 | 1,770,647 | C→G | 100% | P327A (CCC→GCC) | lpxB → | lipid‑A‑disaccharide synthase |
| RA | NC_014034 | 1,781,688 | A→G | 100% | G495G (GGA→GGG) | RCAP_rcc01644 → | FMN‑binding domain‑containing protein |
| RA | NC_014034 | 1,782,184 | T→A | 75.7% | S661T (TCA→ATA) | RCAP_rcc01644 → | FMN‑binding domain‑containing protein |
| RA | NC_014034 | 1,782,185 | C→T | 75.7% | S661L (TCA→ATA) | RCAP_rcc01644 → | FMN‑binding domain‑containing protein |
| RA | NC_014034 | 1,782,188 | T→A | 100% | L662H (CTT→CAT) | RCAP_rcc01644 → | FMN‑binding domain‑containing protein |
| RA | NC_014034 | 1,782,228 | +A | 100% | coding (2025/2892 nt) | RCAP_rcc01644 → | FMN‑binding domain‑containing protein |
| RA | NC_014034 | 1,782,276 | +G | 100% | coding (2073/2892 nt) | RCAP_rcc01644 → | FMN‑binding domain‑containing protein |
| RA | NC_014034 | 1,786,478 | 2 bp→GC | 100% | coding (612‑613/819 nt) | RCAP_rcc01648 → | ABC transporter permease |
| RA | NC_014034 | 1,786,519 | +G | 100% | coding (653/819 nt) | RCAP_rcc01648 → | ABC transporter permease |
| RA | NC_014034 | 1,786,540 | Δ1 bp | 100% | coding (674/819 nt) | RCAP_rcc01648 → | ABC transporter permease |
| RA | NC_014034 | 1,786,541 | C→T | 6.0% | A225A (GCC→GCT) | RCAP_rcc01648 → | ABC transporter permease |
| RA | NC_014034 | 1,791,669 | +G | 100% | intergenic (‑78/‑40) | RCAP_rcc01654 ← / → RCAP_rcc01655 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 1,794,301 | 2 bp→GC | 100% | coding (1193‑1194/1770 nt) | exaA2 → | quinoprotein ethanol dehydrogenase |
| RA | NC_014034 | 1,794,386 | G→C | 100% | G426G (GGG→GGC) | exaA2 → | quinoprotein ethanol dehydrogenase |
| RA | NC_014034 | 1,796,987 | Δ1 bp | 100% | coding (11/2238 nt) | RCAP_rcc01660 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,797,097 | Δ1 bp | 100% | coding (121/2238 nt) | RCAP_rcc01660 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,797,103 | G→C | 100% | G43R (GGC→CGC) | RCAP_rcc01660 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,797,126 | 2 bp→GC | 100% | coding (150‑151/2238 nt) | RCAP_rcc01660 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,797,132 | 2 bp→CG | 100% | coding (156‑157/2238 nt) | RCAP_rcc01660 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,797,143 | +A | 100% | coding (167/2238 nt) | RCAP_rcc01660 → | signal transduction histidine kinase |
| RA | NC_014034 | 1,799,660 | +T | 100% | coding (609/1065 nt) | trmU ← | tRNA (5‑methylaminomethyl‑2‑thiouridylate)‑methyltransferase |
| RA | NC_014034 | 1,799,680 | +T | 100% | coding (589/1065 nt) | trmU ← | tRNA (5‑methylaminomethyl‑2‑thiouridylate)‑methyltransferase |
| RA | NC_014034 | 1,799,685 | +T | 100% | coding (584/1065 nt) | trmU ← | tRNA (5‑methylaminomethyl‑2‑thiouridylate)‑methyltransferase |
| RA | NC_014034 | 1,802,243 | 2 bp→GC | 100% | coding (626‑627/2124 nt) | ligA → | DNA ligase |
| RA | NC_014034 | 1,802,277 | 2 bp→GC | 100% | coding (660‑661/2124 nt) | ligA → | DNA ligase |
| RA | NC_014034 | 1,807,439 | T→C | 100% | S38G (AGT→GGT) | RCAP_rcc01667 ← | methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,807,499 | +C | 100% | coding (52/1413 nt) | RCAP_rcc01667 ← | methyl‑accepting chemotaxis sensory transducer |
| RA | NC_014034 | 1,808,622 | +C | 100% | intergenic (‑28/‑263) | RCAP_rct00023 ← / → RCAP_rcc01670 | tRNA‑Leu/hypothetical protein |
| RA | NC_014034 | 1,808,662 | +T | 100% | intergenic (‑68/‑223) | RCAP_rct00023 ← / → RCAP_rcc01670 | tRNA‑Leu/hypothetical protein |
| RA | NC_014034 | 1,813,081 | T→G | 100% | intergenic (+125/‑93) | glnA3 → / → fabD | glutamine synthetase/ACP S‑malonyltransferase |
| RA | NC_014034 | 1,813,093 | C→G | 100% | intergenic (+137/‑81) | glnA3 → / → fabD | glutamine synthetase/ACP S‑malonyltransferase |
| RA | NC_014034 | 1,813,101 | +G | 100% | intergenic (+145/‑73) | glnA3 → / → fabD | glutamine synthetase/ACP S‑malonyltransferase |
| RA | NC_014034 | 1,813,103 | G→C | 100% | intergenic (+147/‑71) | glnA3 → / → fabD | glutamine synthetase/ACP S‑malonyltransferase |
| RA | NC_014034 | 1,814,111 | 2 bp→GG | 100% | intergenic (+8/‑72) | fabD → / → fabG | ACP S‑malonyltransferase/3‑oxoacyl‑ACP reductase |
| RA | NC_014034 | 1,815,396 | +G | 100% | intergenic (+38/‑29) | acpP1 → / → ligT | acyl carrier protein/2'‑5' RNA ligase |
| RA | NC_014034 | 1,823,740 | +C | 100% | intergenic (+25/‑148) | RCAP_rcc01687 → / → RCAP_rcc01688 | HK97 family phage major capsid protein/hypothetical protein |
| RA | NC_014034 | 1,826,849 | 2 bp→GC | 100% | coding (631‑632/660 nt) | RCAP_rcc01694 → | hypothetical protein |
| RA | NC_014034 | 1,830,149 | C→T | 100% | S430F (TCC→TTC) | RCAP_rcc01698 → | hypothetical protein |
| RA | NC_014034 | 1,836,366 | 2 bp→GC | 100% | coding (502‑503/1257 nt) | pdhC ← | pyruvate dehydrogenase complex E2 component dihydrolipoyllysine‑residue acetyltransferase |
| RA | NC_014034 | 1,837,757 | Δ1 bp | 100% | coding (469/1350 nt) | pdhB ← | pyruvate dehydrogenase complex E1 component pyruvate dehydrogenase (acetyl‑transferring) subunit beta |
| RA | NC_014034 | 1,837,769 | +C | 100% | coding (457/1350 nt) | pdhB ← | pyruvate dehydrogenase complex E1 component pyruvate dehydrogenase (acetyl‑transferring) subunit beta |
| RA | NC_014034 | 1,843,348 | +G | 100% | intergenic (+10/+138) | ppiB → / ← tyrS | peptidyl‑prolyl cis‑trans isomerase B/tyrosyl‑tRNA synthetase |
| RA | NC_014034 | 1,843,359 | Δ1 bp | 100% | intergenic (+21/+127) | ppiB → / ← tyrS | peptidyl‑prolyl cis‑trans isomerase B/tyrosyl‑tRNA synthetase |
| RA | NC_014034 | 1,843,369 | +C | 100% | intergenic (+31/+117) | ppiB → / ← tyrS | peptidyl‑prolyl cis‑trans isomerase B/tyrosyl‑tRNA synthetase |
| RA | NC_014034 | 1,843,420 | +C | 100% | intergenic (+82/+66) | ppiB → / ← tyrS | peptidyl‑prolyl cis‑trans isomerase B/tyrosyl‑tRNA synthetase |
| RA | NC_014034 | 1,843,426 | +G | 100% | intergenic (+88/+60) | ppiB → / ← tyrS | peptidyl‑prolyl cis‑trans isomerase B/tyrosyl‑tRNA synthetase |
| RA | NC_014034 | 1,843,465 | +G | 100% | intergenic (+127/+21) | ppiB → / ← tyrS | peptidyl‑prolyl cis‑trans isomerase B/tyrosyl‑tRNA synthetase |
| RA | NC_014034 | 1,852,959 | 2 bp→GC | 100% | coding (623‑624/1857 nt) | RCAP_rcc01719 ← | ABC transporter ATP‑binding protein |
| RA | NC_014034 | 1,853,624 | +C | 100% | intergenic (‑42/‑167) | RCAP_rcc01719 ← / → ndk | ABC transporter ATP‑binding protein/nucleoside diphosphate kinase |
| RA | NC_014034 | 1,853,627 | C→G | 100% | intergenic (‑45/‑164) | RCAP_rcc01719 ← / → ndk | ABC transporter ATP‑binding protein/nucleoside diphosphate kinase |
| RA | NC_014034 | 1,865,882 | 2 bp→GG | 100% | coding (80‑81/3630 nt) | nifJ ← | pyruvate‑flavodoxin oxidoreductase |
| RA | NC_014034 | 1,867,831 | +C | 5.3% | intergenic (‑233/+82) | RCAP_rcc01729 ← / ← RCAP_rcc01730 | pyridine nucleotide‑disulfide oxidoreductase/U32 family peptidase |
| RA | NC_014034 | 1,867,833 | +C | 100% | intergenic (‑235/+80) | RCAP_rcc01729 ← / ← RCAP_rcc01730 | pyridine nucleotide‑disulfide oxidoreductase/U32 family peptidase |
| RA | NC_014034 | 1,867,956 | +G | 100% | coding (896/939 nt) | RCAP_rcc01730 ← | U32 family peptidase |
| RA | NC_014034 | 1,878,744 | +G | 2.0% | intergenic (+53/‑173) | RCAP_rcc01739 → / → RCAP_rcc01740 | hypothetical protein/ABC transporter ATP‑binding protein |
| RA | NC_014034 | 1,882,945 | 2 bp→GC | 100% | coding (100‑101/747 nt) | RCAP_rcc01743 ← | DSBA family oxidoreductase |
| RA | NC_014034 | 1,886,095 | C→T | 100% | S66F (TCC→TTC) | RCAP_rcc01746 → | hypothetical protein |
| RA | NC_014034 | 1,896,713 | +C | 100% | intergenic (+63/‑25) | RCAP_rcc01753 → / → RCAP_rcc01754 | hypothetical protein/class II glutamine amidotransferase |
| RA | NC_014034 | 1,907,010 | G→C | 100% | R42G (CGG→GGG) | cheY2 ← | chemotaxis protein CheY |
| RA | NC_014034 | 1,907,255 | G→C | 100% | R250G (CGC→GGC) | cheR3 ← | chemotaxis protein methyltransferase CheR |
| RA | NC_014034 | 1,925,099 | +C | 98.1% | intergenic (+39/+6) | RCAP_rcc01778 → / ← RCAP_rcc01779 | hypothetical protein/MazG family protein |
| RA | NC_014034 | 1,927,518 | 2 bp→TG | 100% | coding (185‑186/336 nt) | yajC → | preprotein translocase subunit YajC |
| RA | NC_014034 | 1,931,968 | C→T | 100% | P160S (CCG→TCG) | ccmB → | heme exporter protein B |
| RA | NC_014034 | 1,931,976 | C→G | 100% | L162L (CTC→CTG) | ccmB → | heme exporter protein B |
| RA | NC_014034 | 1,931,978 | 2 bp→TG | 100% | coding (488‑489/657 nt) | ccmB → | heme exporter protein B |
| RA | NC_014034 | 1,941,629 | 2 bp→GC | 100% | coding (1098‑1099/1377 nt) | ntrC → | nitrogen assimilation regulatory protein NtrC |
| RA | NC_014034 | 1,942,895 | 2 bp→GC | 100% | coding (911‑912/2250 nt) | ntrY → | nitrogen regulation protein NtrY |
| RA | NC_014034 | 1,948,851 | +G | 90.0% | coding (1069/2472 nt) | quiP ← | acyl‑homoserine‑lactone acylase |
| RA | NC_014034 | 1,948,855 | +A | 100% | coding (1065/2472 nt) | quiP ← | acyl‑homoserine‑lactone acylase |
| RA | NC_014034 | 1,948,873 | +G | 100% | coding (1047/2472 nt) | quiP ← | acyl‑homoserine‑lactone acylase |
| RA | NC_014034 | 1,950,871 | 2 bp→GC | 100% | coding (855‑856/873 nt) | garR → | 2‑hydroxy‑3‑oxopropionate reductase |
| RA | NC_014034 | 1,950,912 | C→G | 100% | intergenic (+23/+154) | garR → / ← ssb1 | 2‑hydroxy‑3‑oxopropionate reductase/single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,950,913 | +C | 100% | intergenic (+24/+153) | garR → / ← ssb1 | 2‑hydroxy‑3‑oxopropionate reductase/single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,951,161 | C→G | 100% | A145P (GCG→CCG) | ssb1 ← | single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,951,207 | C→G | 92.0% | A129A (GCG→GCC) | ssb1 ← | single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,951,208 | G→C | 92.1% | A129G (GCG→GGG) | ssb1 ← | single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,951,227 | G→C | 100% | R123G (CGC→GGC) | ssb1 ← | single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,951,528 | 2 bp→GC | 100% | coding (65‑66/528 nt) | ssb1 ← | single‑stranded DNA‑binding protein |
| RA | NC_014034 | 1,951,674 | +G | 100% | intergenic (‑81/‑111) | ssb1 ← / → RCAP_rcc01806 | single‑stranded DNA‑binding protein/transglycosylase, Slt family |
| RA | NC_014034 | 1,952,978 | 2 bp→GC | 100% | coding (61‑62/558 nt) | RCAP_rcc01807 ← | hypothetical protein |
| RA | NC_014034 | 1,959,054 | 2 bp→GC | 100% | coding (474‑475/1218 nt) | RCAP_rcc01811 ← | major facilitator superfamily protein |
| RA | NC_014034 | 1,960,661 | +C | 100% | coding (1118/1539 nt) | RCAP_rcc01813 ← | AMP‑dependent synthetase and ligase |
| RA | NC_014034 | 1,960,668 | Δ1 bp | 96.5% | coding (1111/1539 nt) | RCAP_rcc01813 ← | AMP‑dependent synthetase and ligase |
| RA | NC_014034 | 1,960,669 | G→C | 3.4% | G370G (GGC→GGG) | RCAP_rcc01813 ← | AMP‑dependent synthetase and ligase |
| RA | NC_014034 | 1,960,750 | 2 bp→CT | 100% | coding (1028‑1029/1539 nt) | RCAP_rcc01813 ← | AMP‑dependent synthetase and ligase |
| RA | NC_014034 | 1,964,371 | A→C | 100% | intergenic (‑176/‑88) | RCAP_rcc01816 ← / → bdhA | family 5 extracellular solute‑binding protein/3‑hydroxybutyrate dehydrogenase |
| RA | NC_014034 | 1,965,167 | G→T | 100% | A237S (GCC→TCC) | bdhA → | 3‑hydroxybutyrate dehydrogenase |
| RA | NC_014034 | 1,965,239 | G→T | 100% | intergenic (+7/+85) | bdhA → / ← RCAP_rcc01818 | 3‑hydroxybutyrate dehydrogenase/hypothetical protein |
| RA | NC_014034 | 1,965,271 | C→G | 100% | intergenic (+39/+53) | bdhA → / ← RCAP_rcc01818 | 3‑hydroxybutyrate dehydrogenase/hypothetical protein |
| RA | NC_014034 | 1,965,279 | +C | 100% | intergenic (+47/+45) | bdhA → / ← RCAP_rcc01818 | 3‑hydroxybutyrate dehydrogenase/hypothetical protein |
| RA | NC_014034 | 1,970,141 | +G | 100% | intergenic (+172/+161) | tsf → / ← RCAP_rcc01823 | translation elongation factor Ts/LuxR family autoinducer‑binding transcriptional regulator |
| RA | NC_014034 | 1,970,229 | Δ1 bp | 100% | intergenic (+260/+73) | tsf → / ← RCAP_rcc01823 | translation elongation factor Ts/LuxR family autoinducer‑binding transcriptional regulator |
| RA | NC_014034 | 1,974,326 | +G | 100% | intergenic (‑19/+36) | rpe1 ← / ← cbbM | ribulose‑phosphate 3‑epimerase/ribulose bisphosphate carboxylase large subunit |
| RA | NC_014034 | 1,974,330 | +G | 100% | intergenic (‑23/+32) | rpe1 ← / ← cbbM | ribulose‑phosphate 3‑epimerase/ribulose bisphosphate carboxylase large subunit |
| RA | NC_014034 | 1,974,355 | Δ1 bp | 100% | intergenic (‑48/+7) | rpe1 ← / ← cbbM | ribulose‑phosphate 3‑epimerase/ribulose bisphosphate carboxylase large subunit |
| RA | NC_014034 | 1,974,368 | A→C | 100% | V457V (GTT→GTG) | cbbM ← | ribulose bisphosphate carboxylase large subunit |
| RA | NC_014034 | 1,975,364 | T→A | 100% | E125D (GAA→GAT) | cbbM ← | ribulose bisphosphate carboxylase large subunit |
| RA | NC_014034 | 1,976,892 | G→C | 88.1% | intergenic (‑71/+9) | fba ← / ← gap1 | fructose‑bisphosphate aldolase/glyceraldehyde‑3‑phosphate dehydrogenase |
| RA | NC_014034 | 1,976,894 | C→G | 90.3% | intergenic (‑73/+7) | fba ← / ← gap1 | fructose‑bisphosphate aldolase/glyceraldehyde‑3‑phosphate dehydrogenase |
| RA | NC_014034 | 1,976,895 | Δ1 bp | 9.6% | intergenic (‑74/+6) | fba ← / ← gap1 | fructose‑bisphosphate aldolase/glyceraldehyde‑3‑phosphate dehydrogenase |
| RA | NC_014034 | 1,977,552 | G→A | 100% | V117V (GTC→GTT) | gap1 ← | glyceraldehyde‑3‑phosphate dehydrogenase |
| RA | NC_014034 | 1,979,921 | +G | 2.0% | intergenic (‑37/+47) | tkt1 ← / ← cbbP | transketolase/phosphoribulokinase |
| RA | NC_014034 | 1,987,486 | Δ1 bp | 100% | coding (194/2025 nt) | glgX ← | glycogen debranching enzyme GlgX |
| RA | NC_014034 | 1,987,493 | +G | 100% | coding (187/2025 nt) | glgX ← | glycogen debranching enzyme GlgX |
| RA | NC_014034 | 1,990,962 | T→A | 100% | Y555F (TAC→TTC) | glgB ← | 1,4‑alpha‑glucan branching protein |
| RA | NC_014034 | 1,992,043 | 2 bp→GC | 100% | coding (582‑583/2169 nt) | glgB ← | 1,4‑alpha‑glucan branching protein |
| RA | NC_014034 | 1,995,005 | Δ1 bp | 100% | coding (22/2391 nt) | glgP ← | phosphorylase |
| RA | NC_014034 | 1,997,140 | G→C | 100% | R266G (CGC→GGC) | RCAP_rcc01844 ← | sensor histidine kinase |
| RA | NC_014034 | 1,997,981 | +G | 96.0% | intergenic (‑46/‑119) | RCAP_rcc01844 ← / → RCAP_rcc01845 | sensor histidine kinase/hypothetical protein |
| RA | NC_014034 | 2,014,028 | +G | 100% | coding (236/1818 nt) | RCAP_rcc01861 → | hypothetical protein |
| RA | NC_014034 | 2,015,862 | Δ1 bp | 100% | coding (256/957 nt) | xerD → | tyrosine recombinase XerD |
| RA | NC_014034 | 2,025,432 | G→C | 100% | R164R (CGC→CGG) | lpxD ← | UDP‑3‑O‑[3‑hydroxymyristoyl] glucosamine N‑acyltransferase |
| RA | NC_014034 | 2,027,692 | Δ1 bp | 100% | intergenic (‑98/‑255) | RCAP_rcc01873 ← / → RCAP_rcc01874 | peptidoglycan‑binding domain 1 protein/hypothetical protein |
| RA | NC_014034 | 2,027,931 | Δ1 bp | 100% | intergenic (‑337/‑16) | RCAP_rcc01873 ← / → RCAP_rcc01874 | peptidoglycan‑binding domain 1 protein/hypothetical protein |
| RA | NC_014034 | 2,029,172 | C→T | 100% | M270M (GTG→ATG) | sufS1 ← | cysteine desulfurase |
| RA | NC_014034 | 2,032,781 | +C | 100% | coding (329/768 nt) | sufC ← | FeS assembly ATPase SufC |
| RA | NC_014034 | 2,032,787 | +C | 100% | coding (323/768 nt) | sufC ← | FeS assembly ATPase SufC |
| RA | NC_014034 | 2,032,791 | +C | 100% | coding (319/768 nt) | sufC ← | FeS assembly ATPase SufC |
| RA | NC_014034 | 2,035,839 | T→C | 100% | G169G (GGA→GGG) | iscS ← | cysteine desulfurase |
| RA | NC_014034 | 2,036,202 | T→C | 100% | K48K (AAA→AAG) | iscS ← | cysteine desulfurase |
| RA | NC_014034 | 2,036,216 | G→C | 100% | P44A (CCC→GCC) | iscS ← | cysteine desulfurase |
| RA | NC_014034 | 2,036,222 | G→C | 100% | P42A (CCC→GCC) | iscS ← | cysteine desulfurase |
| RA | NC_014034 | 2,040,334 | Δ1 bp | 100% | intergenic (‑82/‑306) | RCAP_rcc01888 ← / → RCAP_rcc01889 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,040,373 | Δ1 bp | 97.4% | intergenic (‑121/‑267) | RCAP_rcc01888 ← / → RCAP_rcc01889 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,040,428 | +C | 100% | intergenic (‑176/‑212) | RCAP_rcc01888 ← / → RCAP_rcc01889 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,040,448 | Δ1 bp | 100% | intergenic (‑196/‑192) | RCAP_rcc01888 ← / → RCAP_rcc01889 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,040,459 | Δ1 bp | 100% | intergenic (‑207/‑181) | RCAP_rcc01888 ← / → RCAP_rcc01889 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,044,155 | +C | 4.5% | intergenic (+28/+149) | typA → / ← potG1 | GTP‑binding protein TypA/BipA/polyamine ABC transporter ATP‑binding protein PotG |
| RA | NC_014034 | 2,044,270 | Δ1 bp | 90.8% | intergenic (+143/+34) | typA → / ← potG1 | GTP‑binding protein TypA/BipA/polyamine ABC transporter ATP‑binding protein PotG |
| RA | NC_014034 | 2,044,275 | A→G | 9.1% | intergenic (+148/+29) | typA → / ← potG1 | GTP‑binding protein TypA/BipA/polyamine ABC transporter ATP‑binding protein PotG |
| RA | NC_014034 | 2,045,611 | T→G | 100% | G208G (GGA→GGC) | potI2 ← | polyamine ABC transporter permease PotI |
| RA | NC_014034 | 2,047,090 | +C | 91.2% | coding (20/879 nt) | potH1 ← | polyamine ABC transporter permease PotH |
| RA | NC_014034 | 2,047,094 | +T | 100% | coding (16/879 nt) | potH1 ← | polyamine ABC transporter permease PotH |
| RA | NC_014034 | 2,047,119 | +C | 100% | intergenic (‑10/+158) | potH1 ← / ← RCAP_rcc01896 | polyamine ABC transporter permease PotH/GntR family transcriptional regulator |
| RA | NC_014034 | 2,047,128 | +G | 100% | intergenic (‑19/+149) | potH1 ← / ← RCAP_rcc01896 | polyamine ABC transporter permease PotH/GntR family transcriptional regulator |
| RA | NC_014034 | 2,047,133 | +G | 100% | intergenic (‑24/+144) | potH1 ← / ← RCAP_rcc01896 | polyamine ABC transporter permease PotH/GntR family transcriptional regulator |
| RA | NC_014034 | 2,048,460 | T→C | 100% | H76R (CAC→CGC) | RCAP_rcc01896 ← | GntR family transcriptional regulator |
| RA | NC_014034 | 2,053,078 | 2 bp→GC | 100% | coding (4156‑4157/6198 nt) | RCAP_rcc01900 ← | hemolysin‑type calcium‑binding repeat family protein |
| RA | NC_014034 | 2,057,308 | Δ1 bp | 2.4% | intergenic (‑74/‑828) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,309 | G→C | 100% | intergenic (‑75/‑827) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,825 | +C | 85.9% | intergenic (‑591/‑311) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,828 | Δ1 bp | 10.7% | intergenic (‑594/‑308) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,830 | +C | 89.3% | intergenic (‑596/‑306) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,833 | +A | 89.3% | intergenic (‑599/‑303) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,834 | A→C | 10.7% | intergenic (‑600/‑302) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,837 | +T | 100% | intergenic (‑603/‑299) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,854 | A→T | 100% | intergenic (‑620/‑282) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,057,860 | +C | 100% | intergenic (‑626/‑276) | RCAP_rcc01900 ← / → RCAP_rcc01901 | hemolysin‑type calcium‑binding repeat family protein/polyphosphate kinase 2 domain‑containing protein |
| RA | NC_014034 | 2,061,087 | +G | 100% | noncoding (56/90 nt) | RCAP_rct00025 → | tRNA‑Ser |
| RA | NC_014034 | 2,061,514 | +G | 100% | intergenic (‑4/+420) | RCAP_rcc01905 ← / ← RCAP_rcc01906 | IS4 family transposase/hypothetical protein |
| RA | NC_014034 | 2,063,533 | 2 bp→GC | 100% | coding (146‑147/567 nt) | RCAP_rcc01908 → | hypothetical protein |
| RA | NC_014034 | 2,068,008 | C→T | 100% | M332M (CTG→TTG) | RCAP_rcc01913 → | MerR family transcriptional regulator |
| RA | NC_014034 | 2,070,633 | +G | 100% | intergenic (+48/+124) | dcd → / ← guaB | deoxycytidine triphosphate deaminase/inosine‑5'‑monophosphate dehydrogenase |
| RA | NC_014034 | 2,073,632 | G→C | 100% | P215A (CCC→GCC) | RCAP_rcc01917 ← | hypothetical protein |
| RA | NC_014034 | 2,073,663 | Δ1 bp | 100% | coding (612/903 nt) | RCAP_rcc01917 ← | hypothetical protein |
| RA | NC_014034 | 2,073,697 | Δ1 bp | 100% | coding (578/903 nt) | RCAP_rcc01917 ← | hypothetical protein |
| RA | NC_014034 | 2,074,602 | +T | 100% | intergenic (+113/‑143) | RCAP_rcc01918 → / → RCAP_rcc01919 | hypothetical protein/membrane protein involved in aromatic hydrocarbon degradation |
| RA | NC_014034 | 2,075,900 | +C | 100% | intergenic (+31/‑82) | RCAP_rcc01919 → / → RCAP_rcc01920 | membrane protein involved in aromatic hydrocarbon degradation/hypothetical protein |
| RA | NC_014034 | 2,090,753 | G→A | 100% | F133F (TTC→TTT) | RCAP_rcc01932 ← | family 4 glycosyl transferase |
| RA | NC_014034 | 2,095,163 | C→G | 100% | P468A (CCC→GCC) | xanB → | mannose‑1‑phosphate guanylyltransferase/mannose‑6‑phosphate isomerase |
| RA | NC_014034 | 2,096,471 | C→A | 100% | W175C (TGG→TGT) | RCAP_rcc01937 ← | hypothetical protein |
| RA | NC_014034 | 2,096,473 | A→C | 100% | W175G (TGG→GGG) | RCAP_rcc01937 ← | hypothetical protein |
| RA | NC_014034 | 2,097,773 | G→A | 100% | P217L (CCG→CTG) | RCAP_rcc01938 ← | hypothetical protein |
| RA | NC_014034 | 2,123,403 | Δ1 bp | 96.9% | coding (769/1077 nt) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,123,404 | A→G | 3.1% | P256P (CCT→CCC) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,123,413 | +G | 100% | coding (759/1077 nt) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,123,416 | T→C | 100% | Q252Q (CAA→CAG) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,123,420 | G→C | 100% | A251G (GCC→GGC) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,123,424 | A→G | 100% | M250M (TTG→CTG) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,123,427 | A→G | 100% | M249M (TTG→CTG) | wza ← | polysaccharide export protein Wza |
| RA | NC_014034 | 2,125,910 | +C | 100% | coding (529/1338 nt) | gid ← | glucose‑inhibited division protein A |
| RA | NC_014034 | 2,125,915 | +G | 100% | coding (524/1338 nt) | gid ← | glucose‑inhibited division protein A |
| RA | NC_014034 | 2,125,920 | +C | 100% | coding (519/1338 nt) | gid ← | glucose‑inhibited division protein A |
| RA | NC_014034 | 2,125,926 | 2 bp→GA | 100% | coding (512‑513/1338 nt) | gid ← | glucose‑inhibited division protein A |
| RA | NC_014034 | 2,130,220 | G→A | 100% | A58V (GCG→GTG) | gyrA ← | DNA gyrase subunit A |
| RA | NC_014034 | 2,132,705 | +C | 100% | intergenic (+32/‑115) | RCAP_rcc01968 → / → RCAP_rct00028 | zinc peptidase/tRNA‑Leu |
| RA | NC_014034 | 2,132,742 | 2 bp→AG | 100% | intergenic (+69/‑77) | RCAP_rcc01968 → / → RCAP_rct00028 | zinc peptidase/tRNA‑Leu |
| RA | NC_014034 | 2,132,751 | +C | 100% | intergenic (+78/‑69) | RCAP_rcc01968 → / → RCAP_rct00028 | zinc peptidase/tRNA‑Leu |
| RA | NC_014034 | 2,135,137 | +G | 100% | intergenic (‑131/+80) | RCAP_rcc01974 ← / ← RCAP_rcc01975 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,136,180 | Δ1 bp | 100% | intergenic (‑349/‑241) | RCAP_rcc01975 ← / → RCAP_rcc01976 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,136,292 | Δ1 bp | 100% | intergenic (‑461/‑129) | RCAP_rcc01975 ← / → RCAP_rcc01976 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,137,620 | +C | 100% | intergenic (+71/‑40) | RCAP_rcc01978 → / → RCAP_rcc01979 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,141,322 | 2 bp→GC | 100% | coding (291‑292/1674 nt) | RCAP_rcc01984 → | phage terminase large subunit |
| RA | NC_014034 | 2,144,454 | C→G | 100% | R157G (CGC→GGC) | RCAP_rcc01986 → | S49 family peptidase |
| RA | NC_014034 | 2,147,529 | Δ1 bp | 100% | coding (539/933 nt) | RCAP_rcc01989 → | hypothetical protein |
| RA | NC_014034 | 2,151,880 | C→G | 100% | P587A (CCG→GCC) | RCAP_rcc01996 → | phage membrane protein |
| RA | NC_014034 | 2,151,882 | G→C | 100% | P587P (CCG→GCC) | RCAP_rcc01996 → | phage membrane protein |
| RA | NC_014034 | 2,155,440 | G→C | 12.0% | S2T (AGC→ACC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,445 | G→A | 14.7% | A4T (GCA→ACC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,447 | A→C | 14.2% | A4A (GCA→ACC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,450 | G→A | 14.5% | R5R (AGG→AGA) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,459 | A→C | 29.1% | V8V (GTA→GTC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,463 | C→G | 32.0% | L10V (CTC→GTC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,466 | G→A | 33.3% | V11M (GTC→ATC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,480 | G→T | 35.0% | W15C (TGG→TGT) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,483 | C→T | 35.1% | G16G (GGC→GGT) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,522 | G→C | 44.0% | R29R (CGG→CGC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,556 | A→C | 39.5% | K41Q (AAG→CAG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,564 | C→G | 40.2% | R43R (CGC→CGG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,567 | C→T | 37.2% | F44F (TTC→TTT) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,568 | C→T | 37.2% | M45M (CTG→TTC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,570 | G→C | 36.3% | L45L (CTG→TTC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,571 | A→G | 37.0% | S46G (AGC→GGG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,573 | C→G | 37.0% | S46R (AGC→GGG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,576 | C→T | 37.2% | R47R (CGC→CGT) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,579 | G→A | 35.8% | E48E (GAG→GAA) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,585 | C→G | 38.5% | L50L (CTC→CTG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,597 | C→G | 38.7% | P54P (CCC→CCG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,600 | C→G | 37.5% | V55V (GTC→GTG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,603 | G→C | 37.6% | A56A (GCG→GCC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,606 | C→G | 36.4% | V57V (GTC→GTG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,647 | A→G | 35.2% | E71G (GAG→GGG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,651 | C→G | 35.0% | L72L (CTC→CTG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,654 | C→G | 35.5% | G73G (GGC→GGG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,660 | C→G | 34.0% | T75T (ACC→ACG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,681 | A→C | 28.2% | A82A (GCA→GCC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,682 | A→T | 28.2% | T83S (ACG→TCG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,693 | T→C | 24.5% | Y86Y (TAT→TAC) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,708 | C→G | 14.3% | G91G (GGC→GGG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,712 | C→G | 11.6% | Q93E (CAG→GAG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,718 | G→C | 6.5% | A95P (GCG→CTG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,155,719 | C→T | 7.0% | A95V (GCG→CTG) | RCAP_rcc02000 → | hypothetical protein |
| RA | NC_014034 | 2,157,144 | G→A | 9.8% | A56T (GCC→ACC) | dam → | adenine‑specific DNA‑methyltransferase |
| RA | NC_014034 | 2,157,926 | 2 bp→AC | 100% | intergenic (‑298/‑483) | RCAP_rcc02004 ← / → RCAP_rcc02005 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,160,409 | 2 bp→GC | 100% | coding (2000‑2001/3858 nt) | RCAP_rcc02005 → | hypothetical protein |
| RA | NC_014034 | 2,162,395 | Δ1 bp | 100% | intergenic (+128/‑329) | RCAP_rcc02005 → / → RCAP_rcc02006 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,162,424 | C→T | 100% | intergenic (+157/‑300) | RCAP_rcc02005 → / → RCAP_rcc02006 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,162,477 | +A | 100% | intergenic (+210/‑247) | RCAP_rcc02005 → / → RCAP_rcc02006 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,162,666 | +G | 100% | intergenic (+399/‑58) | RCAP_rcc02005 → / → RCAP_rcc02006 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,165,863 | +C | 100% | intergenic (‑168/‑216) | RCAP_rcc02007 ← / → tig | phage integrase/trigger factor |
| RA | NC_014034 | 2,165,868 | +C | 100% | intergenic (‑173/‑211) | RCAP_rcc02007 ← / → tig | phage integrase/trigger factor |
| RA | NC_014034 | 2,165,872 | +C | 100% | intergenic (‑177/‑207) | RCAP_rcc02007 ← / → tig | phage integrase/trigger factor |
| RA | NC_014034 | 2,167,639 | +C | 100% | intergenic (+226/+310) | tig → / ← rplI | trigger factor/50S ribosomal protein L9 |
| RA | NC_014034 | 2,170,992 | Δ1 bp | 100% | coding (951/1386 nt) | RCAP_rcc02014 ← | hypothetical protein |
| RA | NC_014034 | 2,171,037 | +C | 100% | coding (906/1386 nt) | RCAP_rcc02014 ← | hypothetical protein |
| RA | NC_014034 | 2,172,596 | 2 bp→GC | 100% | coding (882‑883/1398 nt) | aldH1 ← | aldehyde dehydrogenase |
| RA | NC_014034 | 2,176,106 | +C | 100% | coding (196/1074 nt) | rbsC ← | ribose ABC transporter permease |
| RA | NC_014034 | 2,176,472 | G→C | 100% | A302G (GCG→GGG) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,213 | G→A | 100% | P55L (CCC→CTC) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,270 | +AG | 100% | coding (107/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,276 | +GT | 100% | coding (101/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,285 | +G | 100% | coding (92/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,289 | 2 bp→AT | 100% | coding (87‑88/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,313 | +A | 100% | coding (64/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,342 | +G | 100% | coding (35/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,350 | +C | 100% | coding (27/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,177,365 | +T | 100% | coding (12/990 nt) | rbsB ← | ribose ABC transporter periplasmic ribose‑binding protein |
| RA | NC_014034 | 2,180,161 | +C | 100% | coding (850/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,180,167 | +G | 100% | coding (856/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,180,177 | +C | 100% | coding (866/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,180,185 | 2 bp→GC | 100% | coding (874‑875/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,180,217 | Δ1 bp | 100% | coding (906/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,180,225 | Δ1 bp | 100% | coding (914/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,180,242 | Δ1 bp | 100% | coding (931/1314 nt) | RCAP_rcc02022 → | polyols ABC transporter periplasmic polyols‑binding protein |
| RA | NC_014034 | 2,185,841 | +C | 93.5% | intergenic (+114/‑391) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,185,902 | Δ1 bp | 100% | intergenic (+175/‑330) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,185,930 | +C | 89.9% | intergenic (+203/‑302) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,185,992 | C→G | 100% | intergenic (+265/‑240) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,185,995 | G→C | 100% | intergenic (+268/‑237) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,185,997 | Δ2 bp | 100% | intergenic (+270/‑234) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,186,002 | G→C | 100% | intergenic (+275/‑230) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,186,012 | G→A | 100% | intergenic (+285/‑220) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,186,198 | +G | 100% | intergenic (+471/‑34) | mtlK → / → RCAP_rcc02028 | mannitol 2‑dehydrogenase/FeoA family protein |
| RA | NC_014034 | 2,192,832 | 2 bp→GC | 100% | coding (1626‑1627/2490 nt) | cobZ ← | precorrin 3B synthase CobZ |
| RA | NC_014034 | 2,192,869 | G→A | 100% | H530H (CAC→CAT) | cobZ ← | precorrin 3B synthase CobZ |
| RA | NC_014034 | 2,194,556 | +G | 100% | coding (786/843 nt) | cbiO2 ← | cobalt ABC transporter ATP‑binding protein CbiO |
| RA | NC_014034 | 2,194,591 | Δ1 bp | 100% | coding (751/843 nt) | cbiO2 ← | cobalt ABC transporter ATP‑binding protein CbiO |
| RA | NC_014034 | 2,194,631 | 2 bp→CA | 100% | coding (710‑711/843 nt) | cbiO2 ← | cobalt ABC transporter ATP‑binding protein CbiO |
| RA | NC_014034 | 2,198,487 | A→C | 100% | S128A (TCC→GCC) | cobA2 ← | uroporphyrinogen‑III C‑methyltransferase |
| RA | NC_014034 | 2,198,718 | Δ1 bp | 97.6% | coding (151/729 nt) | cobA2 ← | uroporphyrinogen‑III C‑methyltransferase |
| RA | NC_014034 | 2,198,736 | Δ1 bp | 100% | coding (133/729 nt) | cobA2 ← | uroporphyrinogen‑III C‑methyltransferase |
| RA | NC_014034 | 2,198,748 | Δ1 bp | 100% | coding (121/729 nt) | cobA2 ← | uroporphyrinogen‑III C‑methyltransferase |
| RA | NC_014034 | 2,209,675 | A→G | 100% | intergenic (+7/‑264) | cobO → / → cobQ1 | cob(I)yrinic acid a,c‑diamide adenosyltransferase/cobyric acid synthase CobQ |
| RA | NC_014034 | 2,209,677 | G→C | 100% | intergenic (+9/‑262) | cobO → / → cobQ1 | cob(I)yrinic acid a,c‑diamide adenosyltransferase/cobyric acid synthase CobQ |
| RA | NC_014034 | 2,209,679 | 1 bp→GG | 100% | intergenic (+11/‑260) | cobO → / → cobQ1 | cob(I)yrinic acid a,c‑diamide adenosyltransferase/cobyric acid synthase CobQ |
| RA | NC_014034 | 2,210,082 | C→G | 100% | T48T (ACC→ACG) | cobQ1 → | cobyric acid synthase CobQ |
| RA | NC_014034 | 2,210,243 | T→A | 100% | V102D (GTT→GAT) | cobQ1 → | cobyric acid synthase CobQ |
| RA | NC_014034 | 2,223,116 | Δ1 bp | 100% | coding (1671/3087 nt) | RCAP_rcc02063 ← | M10 family peptidase |
| RA | NC_014034 | 2,223,141 | +C | 100% | coding (1646/3087 nt) | RCAP_rcc02063 ← | M10 family peptidase |
| RA | NC_014034 | 2,232,209 | T→C | 100% | T767A (ACC→GCC) | RCAP_rcc02068 ← | ice nucleation protein repeat family protein |
| RA | NC_014034 | 2,235,575 | 2 bp→GC | 100% | coding (780‑781/1854 nt) | RCAP_rcc02069 → | hypothetical protein |
| RA | NC_014034 | 2,240,244 | +C | 100% | intergenic (+39/+139) | RCAP_rcc02072 → / ← RCAP_rct00029 | nonfunctional major facilitator superfamily protein/tRNA‑Gly |
| RA | NC_014034 | 2,243,214 | 2 bp→GC | 100% | coding (676‑677/1251 nt) | RCAP_rcc02075 ← | PAS/PAC sensor domain‑containing protein |
| RA | NC_014034 | 2,246,716 | C→A | 100% | A68S (GCG→TCG) | RCAP_rcc02078 ← | hypothetical protein |
| RA | NC_014034 | 2,246,724 | C→A | 100% | R65L (CGC→CTC) | RCAP_rcc02078 ← | hypothetical protein |
| RA | NC_014034 | 2,249,280 | +C | 100% | intergenic (‑76/‑229) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,300 | +C | 2.6% | intergenic (‑96/‑209) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,316 | A→C | 5.8% | intergenic (‑112/‑193) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,331 | +C | 1.9% | intergenic (‑127/‑178) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,331 | +A | 1.9% | intergenic (‑127/‑178) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,332 | G→T | 2.4% | intergenic (‑128/‑177) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,333 | G→C | 4.2% | intergenic (‑129/‑176) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,334 | C→A | 2.3% | intergenic (‑130/‑175) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,347 | G→C | 6.4% | intergenic (‑143/‑162) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,348 | A→G | 6.5% | intergenic (‑144/‑161) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,358 | Δ1 bp | 2.5% | intergenic (‑154/‑151) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,359 | G→A | 2.5% | intergenic (‑155/‑150) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,367 | +T | 2.4% | intergenic (‑163/‑142) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,372 | G→C | 2.4% | intergenic (‑168/‑137) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,374 | +A | 2.4% | intergenic (‑170/‑135) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,374 | +G | 2.4% | intergenic (‑170/‑135) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,379 | G→A | 2.4% | intergenic (‑175/‑130) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,380 | A→G | 2.7% | intergenic (‑176/‑129) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,381 | G→A | 2.4% | intergenic (‑177/‑128) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,389 | +C | 2.1% | intergenic (‑185/‑120) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,249,391 | +C | 92.4% | intergenic (‑187/‑118) | parE ← / → RCAP_rcc02080 | DNA topoisomerase IV subunit B/HAD superfamily hydrolase |
| RA | NC_014034 | 2,250,575 | 2 bp→GC | 100% | coding (65‑66/441 nt) | RCAP_rcc02081 → | MaoC family protein |
| RA | NC_014034 | 2,252,630 | +G | 100% | coding (223/1050 nt) | ltaE → | threonine aldolase |
| RA | NC_014034 | 2,253,607 | +C | 100% | noncoding (60/75 nt) | RCAP_rct00030 → | tRNA‑Met |
| RA | NC_014034 | 2,254,807 | A→T | 8.9% | F20Y (TTC→TAC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,812 | G→A | 8.9% | D18D (GAC→GAT) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,818 | A→G | 8.7% | L16L (CTT→CTC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,821 | A→G | 8.3% | R15R (CGT→CGC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,824 | T→C | 8.3% | K14K (AAA→AAG) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,827 | C→G | 7.9% | A13A (GCG→GCC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,830 | C→T | 8.1% | G12G (GGG→GGA) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,833 | C→A | 8.1% | L11L (CTG→CTT) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,837 | T→A | 8.0% | K10M (AAG→ATC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,839 | T→C | 8.0% | R9R (CGA→ATC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,254,851 | C→G | 8.3% | E5D (GAG→GAC) | RCAP_rcc02086 ← | hypothetical protein |
| RA | NC_014034 | 2,256,431 | G→T | 100% | intergenic (+899/+1570) | RCAP_rcc02088 → / ← RCAP_rcc02095 | IS3 family transposase/hypothetical protein |
| RA | NC_014034 | 2,256,434 | +C | 100% | intergenic (+902/+1567) | RCAP_rcc02088 → / ← RCAP_rcc02095 | IS3 family transposase/hypothetical protein |
| RA | NC_014034 | 2,257,836 | Δ1 bp | 100% | intergenic (+2304/+165) | RCAP_rcc02088 → / ← RCAP_rcc02095 | IS3 family transposase/hypothetical protein |
| RA | NC_014034 | 2,262,580 | G→T | 100% | T57K (ACG→AAG) | RCAP_rcc02105 ← | IS3/IS911 family transposase |
| RA | NC_014034 | 2,262,586 | T→C | 100% | Q55R (CAG→CGG) | RCAP_rcc02105 ← | IS3/IS911 family transposase |
| RA | NC_014034 | 2,262,612 | A→G | 100% | G46G (GGT→GGC) | RCAP_rcc02105 ← | IS3/IS911 family transposase |
| RA | NC_014034 | 2,262,738 | T→G | 100% | R4S (AGA→AGC) | RCAP_rcc02105 ← | IS3/IS911 family transposase |
| RA | NC_014034 | 2,268,536 | +C | 100% | intergenic (‑407/+141) | RCAP_rcc02108 ← / ← RCAP_rcc02109 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,279,813 | +C | 100% | intergenic (‑370/+136) | RCAP_rcc02119 ← / ← RCAP_rcc02120 | type 12 family methyltransferase/ABC transporter ATP‑binding/periplasmic substrate‑binding protein |
| RA | NC_014034 | 2,279,867 | Δ1 bp | 100% | intergenic (‑424/+82) | RCAP_rcc02119 ← / ← RCAP_rcc02120 | type 12 family methyltransferase/ABC transporter ATP‑binding/periplasmic substrate‑binding protein |
| RA | NC_014034 | 2,280,672 | C→G | 100% | A118A (GCG→GCC) | RCAP_rcc02120 ← | ABC transporter ATP‑binding/periplasmic substrate‑binding protein |
| RA | NC_014034 | 2,281,001 | +G | 100% | coding (25/1077 nt) | RCAP_rcc02120 ← | ABC transporter ATP‑binding/periplasmic substrate‑binding protein |
| RA | NC_014034 | 2,281,004 | +G | 100% | coding (22/1077 nt) | RCAP_rcc02120 ← | ABC transporter ATP‑binding/periplasmic substrate‑binding protein |
| RA | NC_014034 | 2,281,010 | +G | 100% | coding (16/1077 nt) | RCAP_rcc02120 ← | ABC transporter ATP‑binding/periplasmic substrate‑binding protein |
| RA | NC_014034 | 2,302,850 | Δ1 bp | 2.3% | coding (200/765 nt) | RCAP_rcc02136 → | hypothetical protein |
| RA | NC_014034 | 2,304,879 | Δ1 bp | 100% | coding (2696/2808 nt) | RCAP_rcc02139 ← | methyl‑accepting chemotaxis protein |
| RA | NC_014034 | 2,304,888 | +G | 100% | coding (2687/2808 nt) | RCAP_rcc02139 ← | methyl‑accepting chemotaxis protein |
| RA | NC_014034 | 2,304,896 | +C | 100% | coding (2679/2808 nt) | RCAP_rcc02139 ← | methyl‑accepting chemotaxis protein |
| RA | NC_014034 | 2,304,900 | 2 bp→CA | 100% | coding (2674‑2675/2808 nt) | RCAP_rcc02139 ← | methyl‑accepting chemotaxis protein |
| RA | NC_014034 | 2,304,910 | +G | 100% | coding (2665/2808 nt) | RCAP_rcc02139 ← | methyl‑accepting chemotaxis protein |
| RA | NC_014034 | 2,307,862 | 3 bp→GGC | 100% | coding (933‑935/1203 nt) | RCAP_rcc02140 ← | extracellular ligand‑binding receptor |
| RA | NC_014034 | 2,308,262 | Δ1 bp | 100% | coding (535/1203 nt) | RCAP_rcc02140 ← | extracellular ligand‑binding receptor |
| RA | NC_014034 | 2,308,282 | +C | 100% | coding (515/1203 nt) | RCAP_rcc02140 ← | extracellular ligand‑binding receptor |
| RA | NC_014034 | 2,309,907 | 2 bp→GC | 100% | coding (243‑244/453 nt) | RCAP_rcc02142 → | BadM/Rrf2 family transcriptional regulator |
| RA | NC_014034 | 2,316,703 | C→G | 100% | intergenic (‑11/‑254) | RCAP_rcc02149 ← / → acnA | hypothetical protein/aconitate hydratase |
| RA | NC_014034 | 2,330,175 | +G | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,175 | +G | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,175 | +G | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,175 | +G | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,175 | +C | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,175 | +T | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,175 | +C | 71.4% | intergenic (+150/+162) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,178 | G→C | 100% | intergenic (+153/+159) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,291 | C→G | 100% | intergenic (+266/+46) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,330,295 | +CGGA | 100% | intergenic (+270/+42) | RCAP_rcc02161 → / ← mrcA | hypothetical protein/penicillin‑binding protein 1A |
| RA | NC_014034 | 2,341,833 | Δ1 bp | 100% | intergenic (‑75/+107) | purS ← / ← purC | phosphoribosylformylglycinamidine synthase subunit PurS/phosphoribosylaminoimidazole‑succinocarboxamide synthase |
| RA | NC_014034 | 2,342,443 | C→T | 100% | V87M (GTC→ATC) | purC ← | phosphoribosylaminoimidazole‑succinocarboxamide synthase |
| RA | NC_014034 | 2,343,248 | Δ1 bp | 100% | intergenic (+3/‑215) | RCAP_rcc02171 → / → RCAP_rcc02172 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,365,051 | C→G | 100% | S203T (AGC→ACC) | zntA2 ← | heavy metal translocating P‑type ATPase |
| RA | NC_014034 | 2,365,480 | C→G | 100% | G60A (GGC→GCC) | zntA2 ← | heavy metal translocating P‑type ATPase |
| RA | NC_014034 | 2,373,206 | C→G | 100% | G365G (GGG→GGC) | RCAP_rcc02198 ← | histidine kinase |
| RA | NC_014034 | 2,377,173 | C→G | 100% | M95M (GTG→CTG) | adhE ← | aldehyde‑alcohol dehydrogenase |
| RA | NC_014034 | 2,377,982 | C→T | 100% | G77S (GGT→AGT) | eutN ← | ethanolamine utilization protein EutN |
| RA | NC_014034 | 2,378,928 | G→C | 100% | R276G (CGG→GGG) | eutJ ← | ethanolamine utilization protein EutJ |
| RA | NC_014034 | 2,389,542 | C→G | 100% | A413A (GCC→GCG) | ackA2 → | acetate kinase |
| RA | NC_014034 | 2,391,398 | +G | 100% | coding (2/843 nt) | RCAP_rcc02216 ← | hypothetical protein |
| RA | NC_014034 | 2,394,025 | A→G | 100% | K29R (AAG→AGG) | modC2 → | molybdate ABC transporter ATP‑binding protein ModC |
| RA | NC_014034 | 2,394,542 | 2 bp→CC | 100% | coding (603‑604/708 nt) | modC2 → | molybdate ABC transporter ATP‑binding protein ModC |
| RA | NC_014034 | 2,404,467 | A→T | 100% | V383D (GTT→GAT) | RCAP_rcc02234 ← | oxidoreductase/nitrogenase subunit 1 |
| RA | NC_014034 | 2,404,474 | G→C | 100% | P381A (CCC→GCC) | RCAP_rcc02234 ← | oxidoreductase/nitrogenase subunit 1 |
| RA | NC_014034 | 2,404,595 | A→C | 100% | D340E (GAT→GAG) | RCAP_rcc02234 ← | oxidoreductase/nitrogenase subunit 1 |
| RA | NC_014034 | 2,407,597 | A→C | 100% | W83G (TGG→GGG) | nifH2 ← | nitrogenase iron protein |
| RA | NC_014034 | 2,414,737 | C→A | 100% | A103D (GCC→GAC) | tauA → | taurine ABC transporter periplasmic taurine‑binding protein TauA |
| RA | NC_014034 | 2,419,730 | G→C | 100% | V159V (GTC→GTG) | RCAP_rcc02245 ← | major membrane protein I |
| RA | NC_014034 | 2,419,733 | C→G | 100% | G158G (GGG→GGC) | RCAP_rcc02245 ← | major membrane protein I |
| RA | NC_014034 | 2,420,000 | T→G | 100% | L69L (CTA→CTC) | RCAP_rcc02245 ← | major membrane protein I |
| RA | NC_014034 | 2,420,037 | C→G | 100% | W57S (TGG→TCG) | RCAP_rcc02245 ← | major membrane protein I |
| RA | NC_014034 | 2,420,092 | C→T | 100% | A39T (GCG→ACG) | RCAP_rcc02245 ← | major membrane protein I |
| RA | NC_014034 | 2,420,220 | Δ1 bp | 100% | intergenic (‑14/+178) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,232 | Δ1 bp | 100% | intergenic (‑26/+166) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,239 | Δ1 bp | 100% | intergenic (‑33/+159) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,245 | Δ1 bp | 100% | intergenic (‑39/+153) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,265 | Δ1 bp | 100% | intergenic (‑59/+133) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,299 | Δ1 bp | 100% | intergenic (‑93/+99) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,305 | 2 bp→G | 100% | intergenic (‑99/+92) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,335 | Δ1 bp | 100% | intergenic (‑129/+63) | RCAP_rcc02245 ← / ← cysE2 | major membrane protein I/serine O‑acetyltransferase |
| RA | NC_014034 | 2,420,408 | C→G | 100% | G317A (GGA→GCA) | cysE2 ← | serine O‑acetyltransferase |
| RA | NC_014034 | 2,449,123 | A→G | 100% | E206E (GAA→GAG) | pip → | proline iminopeptidase |
| RA | NC_014034 | 2,461,895 | G→C | 100% | S24S (TCC→TCG) | RCAP_rcc02285 ← | hypothetical protein |
| RA | NC_014034 | 2,462,450 | G→C | 100% | M103M (GTG→CTG) | RCAP_rcc02286 → | divalent ion symporter family |
| RA | NC_014034 | 2,467,061 | G→C | 100% | V29L (GTC→CTC) | RCAP_rcc02292 → | signal transduction histidine kinase |
| RA | NC_014034 | 2,468,847 | G→C | 100% | M6M (GTG→CTG) | RCAP_rcc02293 → | hypothetical protein |
| RA | NC_014034 | 2,470,253 | Δ1 bp | 97.5% | intergenic (‑186/+31) | RCAP_rcc02294 ← / ← proB | signal transduction histidine kinase/glutamate 5‑kinase |
| RA | NC_014034 | 2,472,572 | Δ1 bp | 100% | intergenic (‑157/+26) | RCAP_rcc02296 ← / ← RCAP_rcc02297 | GTP‑binding protein Obg/CgtA/GNAT family acetyltransferase |
| RA | NC_014034 | 2,472,573 | +G | 6.1% | intergenic (‑158/+25) | RCAP_rcc02296 ← / ← RCAP_rcc02297 | GTP‑binding protein Obg/CgtA/GNAT family acetyltransferase |
| RA | NC_014034 | 2,474,914 | Δ1 bp | 100% | intergenic (‑77/+49) | RCAP_rcc02301 ← / ← engA | hypothetical protein/GTP‑binding protein EngA |
| RA | NC_014034 | 2,478,633 | +C | 100% | intergenic (‑94/+163) | RCAP_rcc02304 ← / ← RCAP_rcc02305 | hypothetical protein/heme ABC transporter ATP‑binding/permease |
| RA | NC_014034 | 2,478,759 | +C | 100% | intergenic (‑220/+37) | RCAP_rcc02304 ← / ← RCAP_rcc02305 | hypothetical protein/heme ABC transporter ATP‑binding/permease |
| RA | NC_014034 | 2,481,028 | C→G | 100% | G333A (GGG→GCG) | RCAP_rcc02306 ← | LysM domain‑containing protein |
| RA | NC_014034 | 2,481,041 | T→G | 100% | M329M (ATG→CTG) | RCAP_rcc02306 ← | LysM domain‑containing protein |
| RA | NC_014034 | 2,481,061 | T→G | 100% | E322A (GAG→GCG) | RCAP_rcc02306 ← | LysM domain‑containing protein |
| RA | NC_014034 | 2,486,428 | +G | 98.2% | intergenic (‑56/+138) | RCAP_rcc02312 ← / ← soxG | hypothetical protein/sarcosine oxidase subunit gamma |
| RA | NC_014034 | 2,486,442 | +C | 1.6% | intergenic (‑70/+124) | RCAP_rcc02312 ← / ← soxG | hypothetical protein/sarcosine oxidase subunit gamma |
| RA | NC_014034 | 2,486,448 | +C | 100% | intergenic (‑76/+118) | RCAP_rcc02312 ← / ← soxG | hypothetical protein/sarcosine oxidase subunit gamma |
| RA | NC_014034 | 2,491,405 | G→A | 100% | M107M (CTG→TTG) | soxB ← | sarcosine oxidase subunit beta |
| RA | NC_014034 | 2,493,385 | T→A | 100% | S53T (TCC→ACC) | yqgF → | holliday junction resolvase YqgF |
| RA | NC_014034 | 2,493,394 | C→G | 100% | M56M (CTG→GTG) | yqgF → | holliday junction resolvase YqgF |
| RA | NC_014034 | 2,493,952 | +G | 100% | coding (252/252 nt) | RCAP_rcc02319 → | hypothetical protein |
| RA | NC_014034 | 2,493,970 | G→C | 96.0% | intergenic (+18/‑224) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,493,971 | Δ1 bp | 4.2% | intergenic (+19/‑223) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,003 | A→G | 6.5% | intergenic (+51/‑191) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,014 | A→G | 6.6% | intergenic (+62/‑180) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,015 | C→G | 6.6% | intergenic (+63/‑179) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,016 | C→G | 6.5% | intergenic (+64/‑178) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,018 | G→C | 6.4% | intergenic (+66/‑176) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,022 | Δ1 bp | 6.4% | intergenic (+70/‑172) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,023 | C→A | 6.3% | intergenic (+71/‑171) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,047 | Δ1 bp | 6.7% | intergenic (+95/‑147) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,048 | G→A | 6.7% | intergenic (+96/‑146) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,056 | +T | 6.8% | intergenic (+104/‑138) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,060 | +C | 6.3% | intergenic (+108/‑134) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,061 | G→A | 6.4% | intergenic (+109/‑133) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,061 | +A | 91.6% | intergenic (+109/‑133) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,064 | C→G | 7.0% | intergenic (+112/‑130) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,065 | A→C | 94.3% | intergenic (+113/‑129) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,066 | G→C | 7.5% | intergenic (+114/‑128) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,067 | A→G | 91.5% | intergenic (+115/‑127) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,070 | G→A | 7.1% | intergenic (+118/‑124) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,075 | C→G | 7.7% | intergenic (+123/‑119) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,076 | +C | 10.9% | intergenic (+124/‑118) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,494,080 | +C | 91.0% | intergenic (+128/‑114) | RCAP_rcc02319 → / → RCAP_rcc02320 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 2,496,270 | C→G | 100% | P222A (CCC→GCC) | prfC → | peptide chain release factor 3 |
| RA | NC_014034 | 2,504,147 | C→T | 100% | P492L (CCG→CTG) | RCAP_rcc02329 → | HK97 family phage major capsid protein |
| RA | NC_014034 | 2,513,396 | C→G | 100% | N722K (AAC→AAG) | RCAP_rcc02342 → | hypothetical protein |
| RA | NC_014034 | 2,517,092 | C→G | 100% | G108R (GGG→CGG) | RCAP_rcc02347 ← | hypothetical protein |
| RA | NC_014034 | 2,523,952 | T→G | 100% | I573S (ATC→AGC) | ppiD → | peptidyl‑prolyl cis‑trans isomerase D |
| RA | NC_014034 | 2,525,812 | Δ1 bp | 100% | coding (1405/1494 nt) | RCAP_rcc02356 ← | hypothetical protein |
| RA | NC_014034 | 2,526,995 | A→G | 100% | P74P (CCT→CCC) | RCAP_rcc02356 ← | hypothetical protein |
| RA | NC_014034 | 2,530,485 | C→A | 100% | A50E (GCA→GAA) | lexA → | LexA repressor |
| RA | NC_014034 | 2,531,575 | G→A | 100% | L542L (CTC→CTT) | RCAP_rcc02362 ← | competence protein |
| RA | NC_014034 | 2,531,713 | G→C | 100% | D496E (GAC→GAG) | RCAP_rcc02362 ← | competence protein |
| RA | NC_014034 | 2,534,805 | C→G | 100% | intergenic (+86/‑16) | gltX2 → / → gltA | glutamyl‑tRNA synthetase/citrate (Si)‑synthase |
| RA | NC_014034 | 2,537,516 | T→A | 100% | R84W (AGG→TGG) | mdoG2 ← | glucans biosynthesis protein G |
| RA | NC_014034 | 2,540,517 | G→C | 100% | A496A (GCC→GCG) | araB ← | ribulokinase |
| RA | NC_014034 | 2,540,589 | G→C | 100% | D472E (GAC→GAG) | araB ← | ribulokinase |
| RA | NC_014034 | 2,544,260 | C→A | 2.1% | V190V (GTG→GTT) | RCAP_rcc02372 ← | monosacharide ABC transporter ATP‑binding protein |
| RA | NC_014034 | 2,549,153 | G→A | 100% | G56S (GGC→AGC) | tonB → | protein TonB |
| RA | NC_014034 | 2,551,310 | Δ1 bp | 100% | intergenic (‑45/+124) | RCAP_rcc02379 ← / ← ftsI | CobW/HypB/UreG family cobalamin biosynthesis protein/peptidoglycan synthetase FtsI |
| RA | NC_014034 | 2,551,418 | A→G | 100% | intergenic (‑153/+16) | RCAP_rcc02379 ← / ← ftsI | CobW/HypB/UreG family cobalamin biosynthesis protein/peptidoglycan synthetase FtsI |
| RA | NC_014034 | 2,554,356 | T→C | 100% | N96D (AAC→GAC) | mraW ← | S‑adenosyl‑methyltransferase MraW |
| RA | NC_014034 | 2,555,394 | +G | 100% | intergenic (‑257/+489) | mraZ ← / ← RCAP_rcc02384 | protein MraZ/Mrp/NBP35 family protein |
| RA | NC_014034 | 2,555,696 | +C | 100% | intergenic (‑559/+187) | mraZ ← / ← RCAP_rcc02384 | protein MraZ/Mrp/NBP35 family protein |
| RA | NC_014034 | 2,559,923 | G→C | 100% | intergenic (‑199/+71) | ispZ ← / ← ftsY | intracellular septation protein A/cell division protein FtsY |
| RA | NC_014034 | 2,559,935 | Δ1 bp | 100% | intergenic (‑211/+59) | ispZ ← / ← ftsY | intracellular septation protein A/cell division protein FtsY |
| RA | NC_014034 | 2,560,404 | A→G | 100% | F344L (TTC→CTC) | ftsY ← | cell division protein FtsY |
| RA | NC_014034 | 2,560,879 | G→C | 100% | P185P (CCC→CCG) | ftsY ← | cell division protein FtsY |
| RA | NC_014034 | 2,560,964 | T→C | 100% | N157S (AAC→AGC) | ftsY ← | cell division protein FtsY |
| RA | NC_014034 | 2,566,536 | +G | 100% | intergenic (+8/+186) | purD → / ← sdaA | phosphoribosylamine‑‑glycine ligase/L‑serine ammonia‑lyase |
| RA | NC_014034 | 2,566,555 | C→T | 100% | intergenic (+27/+167) | purD → / ← sdaA | phosphoribosylamine‑‑glycine ligase/L‑serine ammonia‑lyase |
| RA | NC_014034 | 2,566,557 | +G | 100% | intergenic (+29/+165) | purD → / ← sdaA | phosphoribosylamine‑‑glycine ligase/L‑serine ammonia‑lyase |
| RA | NC_014034 | 2,566,613 | T→C | 3.6% | intergenic (+85/+109) | purD → / ← sdaA | phosphoribosylamine‑‑glycine ligase/L‑serine ammonia‑lyase |
| RA | NC_014034 | 2,566,625 | C→G | 3.5% | intergenic (+97/+97) | purD → / ← sdaA | phosphoribosylamine‑‑glycine ligase/L‑serine ammonia‑lyase |
| RA | NC_014034 | 2,566,626 | G→C | 3.5% | intergenic (+98/+96) | purD → / ← sdaA | phosphoribosylamine‑‑glycine ligase/L‑serine ammonia‑lyase |
| RA | NC_014034 | 2,575,144 | G→A | 100% | G220D (GGC→GAC) | degP → | protease Do |
| RA | NC_014034 | 2,577,167 | +CT | 100% | intergenic (+89/‑340) | fdx → / → purU | ferredoxin VI/formyltetrahydrofolate deformylase |
| RA | NC_014034 | 2,577,283 | +G | 100% | intergenic (+205/‑224) | fdx → / → purU | ferredoxin VI/formyltetrahydrofolate deformylase |
| RA | NC_014034 | 2,579,493 | A→C | 100% | S227A (TCC→GCC) | pgi ← | glucose‑6‑phosphate isomerase |
| RA | NC_014034 | 2,590,068 | C→G | 100% | V12L (GTT→CTT) | glnE ← | glutamate‑ammonia‑ligase adenylyltransferase |
| RA | NC_014034 | 2,590,362 | T→C | 100% | T2T (ACT→ACC) | RCAP_rcc02415 → | hypothetical protein |
| RA | NC_014034 | 2,590,499 | T→G | 100% | V48G (GTT→GGT) | RCAP_rcc02415 → | hypothetical protein |
| RA | NC_014034 | 2,595,353 | G→C | 100% | V205V (GTG→GTC) | bglX → | periplasmic beta‑glucosidase |
| RA | NC_014034 | 2,603,050 | A→C | 100% | E160A (GAG→GCG) | RCAP_rcc02427 → | M23 family peptidase |
| RA | NC_014034 | 2,604,446 | C→G | 100% | S163S (TCC→TCG) | RCAP_rcc02428 → | TrkA domain transport protein |
| RA | NC_014034 | 2,613,131 | G→C | 100% | R176G (CGG→GGG) | RCAP_rcc02435 ← | family 2 glycosyl transferase |
| RA | NC_014034 | 2,617,778 | Δ1 bp | 100% | intergenic (‑152/‑462) | RCAP_rcc02439 ← / → RCAP_rcc02440 | hypothetical protein/AsnC/Lrp family transcriptional regulator |
| RA | NC_014034 | 2,620,690 | 2 bp→CT | 100% | coding (1050‑1051/1188 nt) | livJ → | branched‑chain amino acid ABC transporter periplasmic branched‑chain amino acid‑binding protein LivJ |
| RA | NC_014034 | 2,630,045 | T→C | 100% | E120E (GAA→GAG) | potD4 ← | polyamine ABC transporter periplasmic polyamine‑binding protein PotD |
| RA | NC_014034 | 2,640,160 | +C | 100% | intergenic (‑136/+140) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,174 | G→A | 100% | intergenic (‑150/+126) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,182 | A→G | 16.1% | intergenic (‑158/+118) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,184 | G→A | 15.1% | intergenic (‑160/+116) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,191 | G→C | 16.0% | intergenic (‑167/+109) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,192 | A→G | 15.6% | intergenic (‑168/+108) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,193 | A→G | 100% | intergenic (‑169/+107) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,198 | A→G | 15.4% | intergenic (‑174/+102) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,201 | Δ1 bp | 100% | intergenic (‑177/+99) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,204 | A→G | 16.8% | intergenic (‑180/+96) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,207 | Δ1 bp | 14.0% | intergenic (‑183/+93) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,208 | Δ1 bp | 13.5% | intergenic (‑184/+92) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,209 | A→T | 13.4% | intergenic (‑185/+91) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,210 | T→G | 13.8% | intergenic (‑186/+90) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,216 | C→T | 13.0% | intergenic (‑192/+84) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,640,225 | T→C | 12.9% | intergenic (‑201/+75) | thrS ← / ← RCAP_rcc02462 | threonyl‑tRNA synthetase/hypothetical protein |
| RA | NC_014034 | 2,643,571 | T→C | 100% | M287V (ATC→GTC) | RCAP_rcc02463 ← | hemolysin‑type calcium‑binding repeat family protein |
| RA | NC_014034 | 2,646,492 | +C | 3.7% | intergenic (+450/+314) | proS → / ← RCAP_rct00032 | prolyl‑tRNA synthetase/tRNA‑Ala |
| RA | NC_014034 | 2,664,239 | C→G | 100% | G358G (GGG→GGC) | polA ← | DNA polymerase I |
| RA | NC_014034 | 2,678,900 | +C | 100% | intergenic (+29/+58) | RCAP_rcc02495 → / ← RCAP_rcc02496 | GTPase, EngC family/group 1 glycosyl transferase |
| RA | NC_014034 | 2,678,904 | +A | 2.6% | intergenic (+33/+54) | RCAP_rcc02495 → / ← RCAP_rcc02496 | GTPase, EngC family/group 1 glycosyl transferase |
| RA | NC_014034 | 2,702,595 | +G | 100% | noncoding (44/75 nt) | RCAP_rct00034 → | tRNA‑Ala |
| RA | NC_014034 | 2,706,737 | C→G | 100% | C134W (TGC→TGG) | RCAP_rcc02520 → | integrin alpha repeat/hemolysin‑type calcium‑binding repeat family protein |
| RA | NC_014034 | 2,715,979 | A→G | 100% | F8L (TTC→CTC) | amaB ← | N‑carbamoyl‑L‑amino acid amidohydrolase |
| RA | NC_014034 | 2,716,858 | C→G | 100% | intergenic (+271/+3) | RCAP_rcc02527 → / ← RCAP_rcc02528 | XRE family transcriptional regulator/dihydropyrimidine dehydrogenase |
| RA | NC_014034 | 2,725,840 | Δ1 bp | 2.6% | intergenic (‑112/+85) | cysT ← / ← cysK1 | sulfate ABC transporter permease CysT/cysteine synthase |
| RA | NC_014034 | 2,728,522 | T→G | 100% | R635R (CGA→CGC) | RCAP_rcc02539 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 2,729,640 | A→C | 100% | F263V (TTC→GTC) | RCAP_rcc02539 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 2,729,707 | G→C | 100% | H240Q (CAC→CAG) | RCAP_rcc02539 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 2,731,800 | G→C | 100% | P509P (CCC→CCG) | RCAP_rcc02540 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 2,731,802 | G→C | 100% | P509A (CCC→GCC) | RCAP_rcc02540 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 2,747,849 | +G | 100% | intergenic (‑181/+112) | RCAP_rcc02553 ← / ← RCAP_rcc02554 | hypothetical protein/NmrA family protein |
| RA | NC_014034 | 2,747,854 | C→G | 100% | intergenic (‑186/+107) | RCAP_rcc02553 ← / ← RCAP_rcc02554 | hypothetical protein/NmrA family protein |
| RA | NC_014034 | 2,747,869 | +G | 100% | intergenic (‑201/+92) | RCAP_rcc02553 ← / ← RCAP_rcc02554 | hypothetical protein/NmrA family protein |
| RA | NC_014034 | 2,747,876 | 2 bp→GC | 100% | intergenic (‑208/+84) | RCAP_rcc02553 ← / ← RCAP_rcc02554 | hypothetical protein/NmrA family protein |
| RA | NC_014034 | 2,748,027 | G→C | 100% | T256T (ACC→ACG) | RCAP_rcc02554 ← | NmrA family protein |
| RA | NC_014034 | 2,761,064 | C→G | 100% | A303G (GCC→GGC) | RCAP_rcc02572 → | hypothetical protein |
| RA | NC_014034 | 2,765,317 | C→G | 100% | intergenic (‑337/‑144) | RCAP_rct00036 ← / → RCAP_rcc02578 | tRNA‑Asn/iron(III) ABC transporter periplasmic iron(III)‑compound‑binding protein |
| RA | NC_014034 | 2,768,920 | +G | 2.2% | coding (124/876 nt) | RCAP_rcc02580 ← | metallo‑beta‑lactamase |
| RA | NC_014034 | 2,770,015 | C→G | 100% | H311Q (CAC→CAG) | RCAP_rcc02581 → | sensor histidine kinase |
| RA | NC_014034 | 2,770,582 | +G | 100% | coding (1/138 nt) | RCAP_rcc02582 ← | hypothetical protein |
| RA | NC_014034 | 2,771,692 | C→G | 100% | P233A (CCC→GCC) | lon → | ATP‑dependent protease La |
| RA | NC_014034 | 2,778,229 | C→G | 100% | V457L (GTC→CTC) | fadJ ← | fatty acid oxidation complex subunit alpha |
| RA | NC_014034 | 2,789,583 | C→T | 100% | intergenic (+79/‑159) | RCAP_rcc02599 → / → RCAP_rcc02600 | TetR family transcriptional regulator/hypothetical protein |
| RA | NC_014034 | 2,791,928 | A→G | 100% | E319E (GAA→GAG) | accC → | acetyl‑CoA carboxylase biotin carboxylase |
| RA | NC_014034 | 2,791,931 | A→G | 100% | I320M (ATA→ATG) | accC → | acetyl‑CoA carboxylase biotin carboxylase |
| RA | NC_014034 | 2,797,774 | G→A | 100% | G148S (GGC→AGC) | RCAP_rcc02610 → | hypothetical protein |
| RA | NC_014034 | 2,798,351 | G→A | 100% | G146S (GGC→AGC) | mcpA3 → | methyl‑accepting chemotaxis protein McpA |
| RA | NC_014034 | 2,804,167 | T→C | 100% | E130E (GAA→GAG) | ttuD ← | hydroxypyruvate reductase |
| RA | NC_014034 | 2,804,266 | G→C | 100% | T97T (ACC→ACG) | ttuD ← | hydroxypyruvate reductase |
| RA | NC_014034 | 2,808,441 | C→T | 100% | P352L (CCC→CTC) | pyrD2 → | dihydroorotate oxidase |
| RA | NC_014034 | 2,808,557 | +G | 100% | intergenic (+112/+42) | pyrD2 → / ← acsA2 | dihydroorotate oxidase/acetate‑‑CoA ligase |
| RA | NC_014034 | 2,809,617 | G→T | 100% | P318H (CCC→CAC) | acsA2 ← | acetate‑‑CoA ligase |
| RA | NC_014034 | 2,819,668 | G→C | 15.9% | A73G (GCG→GGG) | dacB ← | penicillin‑binding protein 4 |
| RA | NC_014034 | 2,821,448 | +G | 2.7% | coding (197/1062 nt) | RCAP_rcc02629 ← | diguanylate cyclase/phosphodiesterase |
| RA | NC_014034 | 2,864,792 | +A | 100% | intergenic (‑84/‑14) | efp ← / → lysU | translation elongation factor P/lysyl‑tRNA synthetase |
| RA | NC_014034 | 2,867,525 | C→A | 100% | G162W (GGG→TGG) | RCAP_rcc02675 ← | MarR family transcriptional regulator |
| RA | NC_014034 | 2,868,488 | Δ1 bp | 100% | intergenic (‑94/‑32) | RCAP_rcc02676 ← / → aspC2 | hypothetical protein/aspartate aminotransferase |
| RA | NC_014034 | 2,872,628 | T→C | 100% | M39V (ATC→GTC) | mdtK ← | multidrug resistance protein MdtK |
| RA | NC_014034 | 2,873,377 | T→A | 100% | intergenic (‑6/+53) | RCAP_rcc02681 ← / ← RCAP_rcc02682 | cytochrome b561 family protein/cytochrome c' |
| RA | NC_014034 | 2,877,840 | Δ1 bp | 100% | coding (22/759 nt) | hemK → | protein methyltransferase HemK |
| RA | NC_014034 | 2,880,579 | +G | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +C | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +G | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +C | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +G | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +T | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +C | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +A | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +C | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,579 | +A | 73.1% | coding (1006/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,880,582 | +G | 100% | coding (1003/1053 nt) | pdxA ← | 4‑hydroxythreonine‑4‑phosphate dehydrogenase |
| RA | NC_014034 | 2,884,906 | T→C | 100% | K71E (AAG→GAG) | RCAP_rcc02692 ← | organic solvent tolerance protein family |
| RA | NC_014034 | 2,889,387 | C→A | 100% | R138S (CGC→AGC) | holC → | DNA polymerase III subunit chi |
| RA | NC_014034 | 2,891,981 | T→G | 100% | S460A (TCG→GCG) | thiP → | thiamine ABC transporter permease |
| RA | NC_014034 | 2,894,993 | A→G | 100% | L216P (CTG→CCG) | RCAP_rcc02704 ← | NLP/P60 family protein |
| RA | NC_014034 | 2,895,022 | C→G | 100% | A206A (GCG→GCC) | RCAP_rcc02704 ← | NLP/P60 family protein |
| RA | NC_014034 | 2,898,062 | G→C | 100% | T133T (ACG→ACC) | cynT → | carbonate dehydratase |
| RA | NC_014034 | 2,925,524 | +G | 100% | intergenic (+308/‑127) | RCAP_rcc02735 → / → RCAP_rcc02736 | virulence‑associated protein E/hypothetical protein |
| RA | NC_014034 | 2,925,566 | A→C | 100% | intergenic (+350/‑85) | RCAP_rcc02735 → / → RCAP_rcc02736 | virulence‑associated protein E/hypothetical protein |
| RA | NC_014034 | 2,926,430 | Δ1 bp | 100% | coding (53/408 nt) | RCAP_rcc02738 → | hypothetical protein |
| RA | NC_014034 | 2,934,071 | A→C | 100% | M260M (ATG→CTG) | RCAP_rcc02745 → | RND family efflux transporter subunit MFP |
| RA | NC_014034 | 2,950,699 | A→G | 3.0% | intergenic (+42/‑118) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,708 | Δ1 bp | 3.0% | intergenic (+51/‑109) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,711 | A→G | 1.9% | intergenic (+54/‑106) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,712 | C→G | 1.9% | intergenic (+55/‑105) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,713 | A→C | 3.1% | intergenic (+56/‑104) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,714 | C→G | 1.9% | intergenic (+57/‑103) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,715 | G→C | 4.7% | intergenic (+58/‑102) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,716 | C→A | 4.8% | intergenic (+59/‑101) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,717 | C→T | 4.8% | intergenic (+60/‑100) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,718 | C→G | 1.9% | intergenic (+61/‑99) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,719 | C→A | 2.0% | intergenic (+62/‑98) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,725 | T→C | 2.8% | intergenic (+68/‑92) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,732 | C→G | 2.8% | intergenic (+75/‑85) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,733 | C→G | 1.8% | intergenic (+76/‑84) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,742 | +G | 2.9% | intergenic (+85/‑75) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,743 | G→A | 1.7% | intergenic (+86/‑74) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,754 | T→G | 4.2% | intergenic (+97/‑63) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,758 | Δ1 bp | 1.7% | intergenic (+101/‑59) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,759 | Δ1 bp | 2.4% | intergenic (+102/‑58) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,760 | C→A | 4.2% | intergenic (+103/‑57) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,765 | A→C | 4.1% | intergenic (+108/‑52) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,950,779 | T→G | 1.3% | intergenic (+122/‑38) | RCAP_rcc02761 → / → RCAP_rcc02762 | glutathione S‑transferase/4Fe‑4S ferredoxin, iron‑sulfur cluster binding protein |
| RA | NC_014034 | 2,951,891 | G→C | 100% | A7A (GCG→GCC) | RCAP_rcc02763 → | hypothetical protein |
| RA | NC_014034 | 2,953,208 | C→A | 100% | intergenic (+97/+281) | RCAP_rcc02764 → / ← ilvE1 | hypothetical protein/branched‑chain‑amino‑acid transaminase |
| RA | NC_014034 | 2,953,217 | Δ1 bp | 100% | intergenic (+106/+272) | RCAP_rcc02764 → / ← ilvE1 | hypothetical protein/branched‑chain‑amino‑acid transaminase |
| RA | NC_014034 | 2,959,195 | T→C | 100% | E74E (GAA→GAG) | RCAP_rcc02771 ← | TetR family transcriptional regulator |
| RA | NC_014034 | 2,959,273 | T→C | 100% | T48T (ACA→ACG) | RCAP_rcc02771 ← | TetR family transcriptional regulator |
| RA | NC_014034 | 2,960,499 | A→G | 100% | E123E (GAA→GAG) | hisP → | polar amino acid ABC transporter ATP‑binding protein HisP |
| RA | NC_014034 | 2,960,535 | A→G | 100% | E135E (GAA→GAG) | hisP → | polar amino acid ABC transporter ATP‑binding protein HisP |
| RA | NC_014034 | 2,960,586 | A→G | 100% | K152K (AAA→AAG) | hisP → | polar amino acid ABC transporter ATP‑binding protein HisP |
| RA | NC_014034 | 2,962,711 | A→G | 100% | K21E (AAG→GAG) | hisM → | polar amino acid ABC transporter permease HisM |
| RA | NC_014034 | 2,969,954 | C→G | 100% | intergenic (+105/+10) | RCAP_rcc02782 → / ← RCAP_rcc02783 | DegT/DnrJ/EryC1/StrS family aminotransferase/CoA‑binding domain‑containing protein |
| RA | NC_014034 | 2,973,819 | T→A | 100% | V311D (GTT→GAT) | RCAP_rcc02786 → | hemolysin‑type calcium‑binding repeat family protein |
| RA | NC_014034 | 2,977,811 | G→A | 100% | M577M (GTG→ATG) | RCAP_rcc02788 → | hypothetical protein |
| RA | NC_014034 | 2,982,999 | A→G | 100% | V81A (GTG→GCG) | hslR ← | heat shock protein |
| RA | NC_014034 | 2,984,495 | C→G | 100% | G531G (GGG→GGC) | RCAP_rcc02793 ← | helicase domain‑containing protein |
| RA | NC_014034 | 2,986,100 | C→G | 100% | intergenic (‑13/+75) | RCAP_rcc02793 ← / ← RCAP_rcc02794 | helicase domain‑containing protein/hypothetical protein |
| RA | NC_014034 | 2,987,766 | C→T | 100% | H228H (CAC→CAT) | pldB → | lysophospholipase L2 |
| RA | NC_014034 | 2,987,809 | G→C | 100% | M243M (GTG→CTG) | pldB → | lysophospholipase L2 |
| RA | NC_014034 | 2,991,515 | C→T | 100% | D225N (GAC→AAC) | RCAP_rcc02800 ← | hypothetical protein |
| RA | NC_014034 | 2,995,606 | C→A | 9.0% | intergenic (+146/+74) | RCAP_rcc02802 → / ← RCAP_rcc02803 | membrane dipeptidase/hypothetical protein |
| RA | NC_014034 | 2,995,625 | C→G | 14.3% | intergenic (+165/+55) | RCAP_rcc02802 → / ← RCAP_rcc02803 | membrane dipeptidase/hypothetical protein |
| RA | NC_014034 | 2,995,643 | +C | 7.7% | intergenic (+183/+37) | RCAP_rcc02802 → / ← RCAP_rcc02803 | membrane dipeptidase/hypothetical protein |
| RA | NC_014034 | 2,995,659 | +C | 5.2% | intergenic (+199/+21) | RCAP_rcc02802 → / ← RCAP_rcc02803 | membrane dipeptidase/hypothetical protein |
| RA | NC_014034 | 2,995,659 | +A | 5.0% | intergenic (+199/+21) | RCAP_rcc02802 → / ← RCAP_rcc02803 | membrane dipeptidase/hypothetical protein |
| RA | NC_014034 | 2,995,678 | Δ1 bp | 3.5% | intergenic (+218/+2) | RCAP_rcc02802 → / ← RCAP_rcc02803 | membrane dipeptidase/hypothetical protein |
| RA | NC_014034 | 3,003,990 | Δ1 bp | 1.9% | intergenic (+36/+140) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,003,991 | A→T | 1.9% | intergenic (+37/+139) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,020 | A→C | 9.8% | intergenic (+66/+110) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,028 | Δ1 bp | 1.7% | intergenic (+74/+102) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,034 | A→C | 9.2% | intergenic (+80/+96) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,036 | A→C | 8.1% | intergenic (+82/+94) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,037 | T→G | 8.1% | intergenic (+83/+93) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,039 | Δ1 bp | 1.7% | intergenic (+85/+91) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,040 | Δ1 bp | 1.8% | intergenic (+86/+90) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,041 | G→C | 8.0% | intergenic (+87/+89) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,042 | Δ1 bp | 1.7% | intergenic (+88/+88) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,043 | T→G | 9.3% | intergenic (+89/+87) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,044 | T→G | 8.1% | intergenic (+90/+86) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,046 | G→T | 9.7% | intergenic (+92/+84) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,048 | C→A | 9.1% | intergenic (+94/+82) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,053 | A→C | 11.1% | intergenic (+99/+77) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,054 | C→T | 1.8% | intergenic (+100/+76) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,059 | G→C | 2.3% | intergenic (+105/+71) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,062 | C→G | 11.8% | intergenic (+108/+68) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,086 | G→A | 9.9% | intergenic (+132/+44) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,004,101 | A→C | 7.6% | intergenic (+147/+29) | gfo → / ← lrp | glucose‑‑fructose oxidoreductase/leucine‑responsive regulatory protein |
| RA | NC_014034 | 3,011,286 | T→A | 79.8% | intergenic (+85/+57) | purK → / ← RCAP_rcc02822 | phosphoribosylaminoimidazole carboxylase ATPase subunit/lipase |
| RA | NC_014034 | 3,011,287 | A→T | 79.8% | intergenic (+86/+56) | purK → / ← RCAP_rcc02822 | phosphoribosylaminoimidazole carboxylase ATPase subunit/lipase |
| RA | NC_014034 | 3,013,336 | G→C | 100% | R34S (AGG→AGC) | RCAP_rcc02824 → | DSBA family oxidoreductase |
| RA | NC_014034 | 3,016,747 | +T | 100% | intergenic (‑81/+28) | RCAP_rcc02827 ← / ← RCAP_rcc02828 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 3,023,828 | Δ1 bp | 100% | intergenic (‑6/+61) | chvG ← / ← chvI | sensor histidine kinase ChvG/transcriptional regulator ChvI |
| RA | NC_014034 | 3,024,766 | Δ1 bp | 100% | intergenic (‑176/‑152) | chvI ← / → pckA | transcriptional regulator ChvI/phosphoenolpyruvate carboxykinase |
| RA | NC_014034 | 3,037,097 | +G | 100% | intergenic (‑215/‑10) | torC ← / → torR | trimethylamine‑N‑oxide reductase c‑type cytochrome TorC/TorCAD operon transcriptional regulatory protein TorR |
| RA | NC_014034 | 3,042,953 | G→T | 100% | W217L (TGG→TTG) | thiD → | phosphomethylpyrimidine kinase |
| RA | NC_014034 | 3,068,130 | T→C | 2.3% | intergenic (‑113/+179) | glcD ← / ← RCAP_rcc02872 | glycolate dehydrogenase, subunit GlcD/hypothetical protein |
| RA | NC_014034 | 3,068,163 | A→T | 3.0% | intergenic (‑146/+146) | glcD ← / ← RCAP_rcc02872 | glycolate dehydrogenase, subunit GlcD/hypothetical protein |
| RA | NC_014034 | 3,068,179 | A→T | 2.5% | intergenic (‑162/+130) | glcD ← / ← RCAP_rcc02872 | glycolate dehydrogenase, subunit GlcD/hypothetical protein |
| RA | NC_014034 | 3,068,180 | T→C | 2.5% | intergenic (‑163/+129) | glcD ← / ← RCAP_rcc02872 | glycolate dehydrogenase, subunit GlcD/hypothetical protein |
| RA | NC_014034 | 3,080,098 | C→G | 100% | P52R (CCG→CGG) | RCAP_rcc02883 → | DeoR family transcriptional regulator |
| RA | NC_014034 | 3,096,211 | G→C | 100% | T88T (ACG→ACC) | RCAP_rcc02897 → | sensor histidine kinase |
| RA | NC_014034 | 3,103,538 | G→A | 100% | R915W (CGG→TGG) | RCAP_rcc02907 ← | hypothetical protein |
| RA | NC_014034 | 3,106,571 | T→C | 100% | Q31Q (CAA→CAG) | RCAP_rcc02908 ← | hypothetical protein |
| JC | NC_014034 | 3,112,237 | +GGC | 100% | coding (382/438 nt) | RCAP_rcc02916 ← | hypothetical protein |
| RA | NC_014034 | 3,119,454 | +G | 95.0% | intergenic (+657/+940) | RCAP_rcc02928 → / ← RCAP_rcc02929 | XRE family transcriptional regulator/hypothetical protein |
| RA | NC_014034 | 3,122,354 | Δ1 bp | 100% | coding (833/837 nt) | RCAP_rcc02930 ← | hypothetical protein |
| RA | NC_014034 | 3,133,510 | +G | 100% | coding (304/315 nt) | RCAP_rcc02941 ← | hypothetical protein |
| RA | NC_014034 | 3,134,055 | A→G | 100% | A84A (GCT→GCC) | RCAP_rcc02942 ← | hypothetical protein |
| RA | NC_014034 | 3,134,163 | A→G | 100% | T48T (ACT→ACC) | RCAP_rcc02942 ← | hypothetical protein |
| RA | NC_014034 | 3,137,302 | C→A | 7.8% | L104F (TTG→TTT) | RCAP_rcc02947 ← | hypothetical protein |
| RA | NC_014034 | 3,143,433 | G→C | 100% | A417A (GCC→GCG) | RCAP_rcc02954 ← | mechanosensitive ion channel family protein |
| RA | NC_014034 | 3,173,548 | +C | 100% | intergenic (+583/‑99) | tyrA → / → RCAP_rcc02983 | prephenate dehydrogenase/extensin family protein |
| RA | NC_014034 | 3,173,565 | +C | 100% | intergenic (+600/‑82) | tyrA → / → RCAP_rcc02983 | prephenate dehydrogenase/extensin family protein |
| RA | NC_014034 | 3,211,264 | +G | 100% | coding (116/1344 nt) | RCAP_rcc03018 ← | hypothetical protein |
| RA | NC_014034 | 3,211,278 | +G | 100% | coding (102/1344 nt) | RCAP_rcc03018 ← | hypothetical protein |
| RA | NC_014034 | 3,211,293 | +C | 100% | coding (87/1344 nt) | RCAP_rcc03018 ← | hypothetical protein |
| RA | NC_014034 | 3,212,707 | T→G | 100% | intergenic (‑1328/+30) | RCAP_rcc03018 ← / ← dctM3 | hypothetical protein/TRAP C4‑dicarboxylate transport system permease subunit DctM |
| RA | NC_014034 | 3,216,136 | C→A | 100% | A65D (GCT→GAT) | dctS3 → | C4‑dicarboxylate transport sensor protein DctS |
| RA | NC_014034 | 3,223,935 | G→C | 100% | P129A (CCC→GCC) | fdhD ← | formate dehydrogenase accessory protein FdhD |
| RA | NC_014034 | 3,241,905 | Δ1 bp | 100% | intergenic (+144/‑38) | rplY → / → pth | 50S ribosomal protein L25/aminoacyl‑tRNA hydrolase |
| RA | NC_014034 | 3,254,685 | C→A | 100% | intergenic (+10/‑173) | glpX → / → recJ | fructose‑1,6‑bisphosphatase/single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,254,687 | Δ1 bp | 100% | intergenic (+12/‑171) | glpX → / → recJ | fructose‑1,6‑bisphosphatase/single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,254,694 | A→C | 100% | intergenic (+19/‑164) | glpX → / → recJ | fructose‑1,6‑bisphosphatase/single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,164 | +G | 100% | coding (1307/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,171 | +C | 100% | coding (1314/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,175 | +C | 100% | coding (1318/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,180 | +C | 100% | coding (1323/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,189 | +C | 96.2% | coding (1332/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,190 | A→C | 4.0% | K445Q (AAG→CCG) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,191 | A→C | 96.2% | K445T (AAG→CCG) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,195 | +G | 100% | coding (1338/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,201 | +T | 100% | coding (1344/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,204 | T→C | 100% | C449C (TGT→TGC) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,220 | +G | 100% | coding (1363/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,256,225 | +G | 100% | coding (1368/1734 nt) | recJ → | single‑stranded‑DNA‑specific exonuclease RecJ |
| RA | NC_014034 | 3,258,963 | +C | 100% | coding (778/1971 nt) | efeU → | ferrous iron permease EfeU |
| RA | NC_014034 | 3,305,280 | C→T | 100% | A10V (GCG→GTG) | RCAP_rcc03110 → | ABC transporter ATP‑binding/permease |
| RA | NC_014034 | 3,309,461 | T→C | 100% | E232E (GAA→GAG) | RCAP_rcc03113 ← | hypothetical protein |
| RA | NC_014034 | 3,328,528 | +G | 100% | intergenic (‑49/+11) | entB ← / ← argF | isochorismatase/ornithine carbamoyltransferase |
| RA | NC_014034 | 3,333,494 | C→G | 100% | intergenic (+40/‑126) | ccmH → / → paaG | cytochrome c‑type biogenesis protein CcmH/enoyl‑CoA hydratase |
| RA | NC_014034 | 3,342,548 | A→G | 100% | V160A (GTG→GCG) | RCAP_rcc03145 ← | AsnC/Lrp family transcriptional regulator |
| RA | NC_014034 | 3,342,552 | A→G | 100% | W159R (TGG→CGG) | RCAP_rcc03145 ← | AsnC/Lrp family transcriptional regulator |
| RA | NC_014034 | 3,342,563 | A→C | 100% | L155R (CTG→CGG) | RCAP_rcc03145 ← | AsnC/Lrp family transcriptional regulator |
| RA | NC_014034 | 3,342,566 | C→G | 100% | R154P (CGG→CCG) | RCAP_rcc03145 ← | AsnC/Lrp family transcriptional regulator |
| RA | NC_014034 | 3,394,235 | C→G | 100% | R263P (CGG→CCG) | RCAP_rcc03194 ← | hypothetical protein |
| RA | NC_014034 | 3,394,236 | +C | 2.3% | coding (787/831 nt) | RCAP_rcc03194 ← | hypothetical protein |
| RA | NC_014034 | 3,394,298 | C→T | 100% | R242Q (CGG→CAG) | RCAP_rcc03194 ← | hypothetical protein |
| RA | NC_014034 | 3,394,363 | T→C | 100% | E220E (GAA→GAG) | RCAP_rcc03194 ← | hypothetical protein |
| RA | NC_014034 | 3,394,395 | G→C | 100% | P210A (CCC→GCC) | RCAP_rcc03194 ← | hypothetical protein |
| RA | NC_014034 | 3,394,438 | A→C | 100% | L195L (CTT→CTG) | RCAP_rcc03194 ← | hypothetical protein |
| RA | NC_014034 | 3,398,880 | G→A | 100% | P228L (CCG→CTG) | tolQ ← | TolQ protein |
| RA | NC_014034 | 3,398,929 | C→T | 100% | E212K (GAG→AAG) | tolQ ← | TolQ protein |
| RA | NC_014034 | 3,423,676 | C→T | 100% | A260T (GCC→ACC) | capD ← | polysaccharide biosynthesis protein CapD |
| RA | NC_014034 | 3,428,794 | C→A | 100% | intergenic (+55/‑9) | RCAP_rcc03228 → / → RCAP_rcc03229 | universal stress family protein/NifU domain‑containing protein |
| RA | NC_014034 | 3,439,791 | Δ1 bp | 2.6% | intergenic (‑94/+69) | RCAP_rcc03240 ← / ← mutB | ATPase AAA/methylmalonyl‑CoA mutase large subunit |
| RA | NC_014034 | 3,439,829 | T→G | 3.5% | intergenic (‑132/+31) | RCAP_rcc03240 ← / ← mutB | ATPase AAA/methylmalonyl‑CoA mutase large subunit |
| RA | NC_014034 | 3,439,831 | +C | 2.8% | intergenic (‑134/+29) | RCAP_rcc03240 ← / ← mutB | ATPase AAA/methylmalonyl‑CoA mutase large subunit |
| RA | NC_014034 | 3,439,831 | +G | 2.8% | intergenic (‑134/+29) | RCAP_rcc03240 ← / ← mutB | ATPase AAA/methylmalonyl‑CoA mutase large subunit |
| RA | NC_014034 | 3,439,846 | Δ1 bp | 100% | intergenic (‑149/+14) | RCAP_rcc03240 ← / ← mutB | ATPase AAA/methylmalonyl‑CoA mutase large subunit |
| RA | NC_014034 | 3,461,372 | Δ1 bp | 69.8% | intergenic (‑82/+48) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,376 | +C | 28.5% | intergenic (‑86/+44) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,379 | Δ1 bp | 71.5% | intergenic (‑89/+41) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,382 | C→A | 100% | intergenic (‑92/+38) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,385 | Δ1 bp | 96.8% | intergenic (‑95/+35) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,386 | Δ1 bp | 96.8% | intergenic (‑96/+34) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,392 | G→C | 100% | intergenic (‑102/+28) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,461,398 | +G | 100% | intergenic (‑108/+22) | RCAP_rcc03260 ← / ← RCAP_rcc03261 | NAD‑dependent epimerase/dehydratase/TOBE domain‑containing protein |
| RA | NC_014034 | 3,498,612 | C→T | 100% | A142T (GCC→ACC) | dapE ← | succinyl‑diaminopimelate desuccinylase |
| RA | NC_014034 | 3,504,126 | +G | 1.9% | intergenic (‑19/+64) | recO ← / ← RCAP_rcc03309 | DNA repair protein RecO/hypothetical protein |
| RA | NC_014034 | 3,519,469 | C→G | 100% | A305P (GCG→CCG) | ftsK ← | cell division protein FtsK |
| RA | NC_014034 | 3,530,179 | A→G | 100% | E517E (GAA→GAG) | aceB → | malate synthase |
| RA | NC_014034 | 3,531,604 | T→C | 100% | A410A (GCT→GCC) | aceA → | isocitrate lyase |
| RA | NC_014034 | 3,531,653 | T→C | 100% | F427L (TTC→CTC) | aceA → | isocitrate lyase |
| RA | NC_014034 | 3,531,673 | G→C | 100% | A433A (GCG→GCC) | aceA → | isocitrate lyase |
| RA | NC_014034 | 3,532,402 | +C | 100% | coding (2/342 nt) | RCAP_rcc03339 ← | hypothetical protein |
| RA | NC_014034 | 3,532,954 | +G | 100% | coding (28/588 nt) | RCAP_rcc03340 ← | hypothetical protein |
| RA | NC_014034 | 3,532,987 | +G | 92.2% | intergenic (‑6/‑19) | RCAP_rcc03340 ← / → RCAP_rcc03341 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 3,532,992 | +G | 100% | intergenic (‑11/‑14) | RCAP_rcc03340 ← / → RCAP_rcc03341 | hypothetical protein/hypothetical protein |
| RA | NC_014034 | 3,533,015 | A→G | 100% | T4A (ACC→GCC) | RCAP_rcc03341 → | hypothetical protein |
| RA | NC_014034 | 3,533,049 | +C | 100% | coding (44/678 nt) | RCAP_rcc03341 → | hypothetical protein |
| RA | NC_014034 | 3,533,655 | C→G | 100% | T217S (ACC→AGC) | RCAP_rcc03341 → | hypothetical protein |
| RA | NC_014034 | 3,533,828 | +C | 100% | intergenic (+145/‑124) | RCAP_rcc03341 → / → nrdD | hypothetical protein/anaerobic ribonucleoside‑triphosphate reductase |
| RA | NC_014034 | 3,537,921 | T→C | 100% | E91E (GAA→GAG) | RCAP_rcc03345 ← | XRE family transcriptional regulator |
| RA | NC_014034 | 3,538,258 | Δ1 bp | 100% | intergenic (‑65/‑53) | RCAP_rcc03345 ← / → RCAP_rcc03346 | XRE family transcriptional regulator/thioesterase superfamily protein |
| RA | NC_014034 | 3,539,498 | T→G | 100% | D261E (GAT→GAG) | prpD → | 2‑methylcitrate dehydratase |
| RA | NC_014034 | 3,541,575 | G→C | 100% | S53S (TCG→TCC) | prpB → | methylisocitrate lyase |
| RA | NC_014034 | 3,542,001 | T→C | 100% | T195T (ACT→ACC) | prpB → | methylisocitrate lyase |
| RA | NC_014034 | 3,548,778 | +G | 100% | intergenic (‑78/+32) | metH1 ← / ← cobQ2 | methionine synthase subunit A/cobyric acid synthase CobQ |
| RA | NC_014034 | 3,560,903 | Δ1 bp | 100% | coding (311/1134 nt) | bioF → | 8‑amino‑7‑oxononanoate synthase |
| RA | NC_014034 | 3,560,922 | +G | 100% | coding (330/1134 nt) | bioF → | 8‑amino‑7‑oxononanoate synthase |
| RA | NC_014034 | 3,565,898 | G→C | 100% | T41T (ACG→ACC) | RCAP_rcc03370 → | LysR family transcriptional regulator |
| RA | NC_014034 | 3,596,459 | C→G | 100% | G470G (GGC→GGG) | RCAP_rcc03391 → | type I secretion system ATPase |
| RA | NC_014034 | 3,609,070 | +G | 100% | intergenic (+9/‑162) | clpB → / → dinB | chaperone ClpB/DNA polymerase IV |
| RA | NC_014034 | 3,609,080 | +C | 100% | intergenic (+19/‑152) | clpB → / → dinB | chaperone ClpB/DNA polymerase IV |
| RA | NC_014034 | 3,609,108 | +G | 100% | intergenic (+47/‑124) | clpB → / → dinB | chaperone ClpB/DNA polymerase IV |
| RA | NC_014034 | 3,609,180 | +G | 100% | intergenic (+119/‑52) | clpB → / → dinB | chaperone ClpB/DNA polymerase IV |
| RA | NC_014034 | 3,648,333 | +G | 100% | intergenic (‑83/‑73) | serB ← / → serC | phosphoserine phosphatase SerB/phosphoserine aminotransferase |
| RA | NC_014034 | 3,694,485 | C→A | 100% | N307K (AAC→AAA) | RCAP_rcc03487 → | hypothetical protein |
| RA | NC_014034 | 3,694,572 | C→A | 100% | G336G (GGC→GGA) | RCAP_rcc03487 → | hypothetical protein |
| RA | NC_014034 | 3,697,631 | G→C | 100% | S124S (TCC→TCG) | hemN3 ← | oxygen‑independent coproporphyrinogen‑III oxidase |
| RA | NC_014034 | 3,701,433 | +GGGCTTC | 100% | intergenic (+10/+39) | grpE → / ← mutS | GrpE protein/DNA mismatch repair protein MutS |
| RA | NC_014034 | 3,705,458 | A→C | 100% | I412I (ATA→ATC) | maeB2 → | malate dehydrogenase |
| RA | NC_014035 | 34,743 | Δ1 bp | 100% | coding (399/1041 nt) | RCAP_rcp00049 ← | iron siderophore/cobalamin ABC transporter permease |
| RA | NC_014035 | 104,664 | G→C | 100% | intergenic (‑39/+161) | cbiO4 ← / ← madM | cobalt ABC transporter ATP‑binding protein CbiO‑4/malonate:sodium symporter subunit MadM |
| Unassigned missing coverage evidence | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| seq id | start | end | size | ←reads | reads→ | gene | description | |||
| * | * | ÷ | NC_014034 | 854770 | 854974 | 205 | 137 [131] | [133] 136 | [hypD]–[hypE] | [hypD], [hypE] |
| * | * | ÷ | NC_014034 | 3211306 | 3212687 | 1382 | 136 [133] | [131] 136 | [RCAP_rcc03018] | [RCAP_rcc03018] |
| Unassigned new junction evidence... | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| seq id | position | reads (cov) | reads (cov) | score | skew | freq | annotation | gene | product | ||
| * | ? | NC_014034 | 221962 = | 425 (2.300) | 164 (0.890) | 68/156 | 3.0 | 0.34 | coding (695/2748 nt) | RCAP_rcc00185 | hypothetical protein |
| ? | NC_014034 | = 222128 | 205 (0.860) | coding (529/2748 nt) | RCAP_rcc00185 | hypothetical protein | |||||